Transcript: Mouse XM_006512730.3

PREDICTED: Mus musculus TATA box binding protein-like 1 (Tbpl1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbpl1 (237336)
Length:
3005
CDS:
506..1066

Additional Resources:

NCBI RefSeq record:
XM_006512730.3
NBCI Gene record:
Tbpl1 (237336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512730.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375313 GCGTGATGTTGGGAAAGTATT pLKO_005 628 CDS 100% 13.200 18.480 N Tbpl1 n/a
2 TRCN0000375314 GGGCACCAAAGAACCTGTAAA pLKO_005 1440 3UTR 100% 13.200 18.480 N Tbpl1 n/a
3 TRCN0000119929 GCTATCGGATAAAGTCTCTAA pLKO.1 921 CDS 100% 4.950 6.930 N Tbpl1 n/a
4 TRCN0000329248 GCTATCGGATAAAGTCTCTAA pLKO_005 921 CDS 100% 4.950 6.930 N Tbpl1 n/a
5 TRCN0000119931 AGATCCGTTTGCCAGAATTTA pLKO.1 846 CDS 100% 15.000 10.500 N Tbpl1 n/a
6 TRCN0000329174 AGATCCGTTTGCCAGAATTTA pLKO_005 846 CDS 100% 15.000 10.500 N Tbpl1 n/a
7 TRCN0000274327 CAAGTGAAGAAGAAGCTAAAT pLKO_005 720 CDS 100% 13.200 9.240 N TBPL1 n/a
8 TRCN0000119930 CCTAGAATTACAGCTACAATT pLKO.1 665 CDS 100% 13.200 9.240 N Tbpl1 n/a
9 TRCN0000329247 CCTAGAATTACAGCTACAATT pLKO_005 665 CDS 100% 13.200 9.240 N Tbpl1 n/a
10 TRCN0000013465 ACCTAGAATTACAGCTACAAT pLKO.1 664 CDS 100% 5.625 3.938 N TBPL1 n/a
11 TRCN0000274264 ACCTAGAATTACAGCTACAAT pLKO_005 664 CDS 100% 5.625 3.938 N TBPL1 n/a
12 TRCN0000119927 CCCATAATTCATTGTGACTTT pLKO.1 2510 3UTR 100% 4.950 3.465 N Tbpl1 n/a
13 TRCN0000119928 GCAGTGTGTAACATGCCCTTT pLKO.1 824 CDS 100% 4.050 2.430 N Tbpl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512730.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478439 ATCCGCCCTTAGCAGCACTGAATC pLX_317 66.2% 94% 99.4% V5 (many diffs) n/a
2 ccsbBroadEn_07437 pDONR223 100% 93.9% 98.9% None (many diffs) n/a
3 ccsbBroad304_07437 pLX_304 0% 93.9% 98.9% V5 (many diffs) n/a
Download CSV