Transcript: Mouse XM_006512932.2

PREDICTED: Mus musculus WAS protein family, member 1 (Wasf1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wasf1 (83767)
Length:
2910
CDS:
465..2144

Additional Resources:

NCBI RefSeq record:
XM_006512932.2
NBCI Gene record:
Wasf1 (83767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233964 GAAACACTGCCTCGATTATAT pLKO_005 2623 3UTR 100% 15.000 21.000 N Wasf1 n/a
2 TRCN0000218314 ACAGACATACGTGGATCATAT pLKO_005 1181 CDS 100% 13.200 18.480 N Wasf1 n/a
3 TRCN0000012405 CCACAGACATACGTGGATCAT pLKO.1 1179 CDS 100% 4.950 6.930 N Wasf1 n/a
4 TRCN0000012403 CCGTTATTAGAGTAGCAGATT pLKO.1 2461 3UTR 100% 4.950 6.930 N Wasf1 n/a
5 TRCN0000012404 GCAAGATATAACGATGAGAAA pLKO.1 740 CDS 100% 4.950 6.930 N Wasf1 n/a
6 TRCN0000233962 TGAGTAGCCTAAGTAAGTATG pLKO_005 586 CDS 100% 10.800 8.640 N Wasf1 n/a
7 TRCN0000233963 ACCTCCTACACAAGCATATTG pLKO_005 1120 CDS 100% 13.200 9.240 N Wasf1 n/a
8 TRCN0000012407 CGAACTGGAATGTGTAACCAA pLKO.1 536 CDS 100% 3.000 2.100 N Wasf1 n/a
9 TRCN0000012406 CCACTTCTTCACTAAGAGCTT pLKO.1 1471 CDS 100% 2.640 1.848 N Wasf1 n/a
10 TRCN0000122994 CCCACTTATATATTGTGTGAT pLKO.1 2767 3UTR 100% 4.950 3.960 N WASF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02051 pDONR223 100% 90.9% 98.3% None (many diffs) n/a
2 ccsbBroad304_02051 pLX_304 0% 90.9% 98.3% V5 (many diffs) n/a
3 TRCN0000473597 GCAGCGTCAATGTAGAGTAAAGAA pLX_317 19.9% 90.9% 98.3% V5 (many diffs) n/a
Download CSV