Transcript: Mouse XM_006513074.3

PREDICTED: Mus musculus LIM and senescent cell antigen-like domains 1 (Lims1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lims1 (110829)
Length:
2893
CDS:
1919..2275

Additional Resources:

NCBI RefSeq record:
XM_006513074.3
NBCI Gene record:
Lims1 (110829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513074.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071465 GAGAAGATCGTGAACAGTAAT pLKO.1 2165 CDS 100% 13.200 18.480 N Lims1 n/a
2 TRCN0000301713 GAGAAGATCGTGAACAGTAAT pLKO_005 2165 CDS 100% 13.200 18.480 N Lims1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513074.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04624 pDONR223 100% 86.7% 89.8% None (many diffs) n/a
2 ccsbBroad304_04624 pLX_304 0% 86.7% 89.8% V5 (many diffs) n/a
3 TRCN0000469496 CCTGCACGGGACAGCCCGTCTAAT pLX_317 100% 86.7% 89.8% V5 (many diffs) n/a
4 ccsbBroadEn_06524 pDONR223 100% 13% 13.9% None (many diffs) n/a
5 ccsbBroad304_06524 pLX_304 0% 13% 13.9% V5 (many diffs) n/a
6 TRCN0000468941 TAGATCCTATTATCCCACTCTTGT pLX_317 39.8% 13% 13.9% V5 (many diffs) n/a
Download CSV