Transcript: Mouse XM_006513100.3

PREDICTED: Mus musculus advillin (Avil), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Avil (11567)
Length:
3905
CDS:
931..3480

Additional Resources:

NCBI RefSeq record:
XM_006513100.3
NBCI Gene record:
Avil (11567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090782 TCTCGGAACAAGACTTTGTAT pLKO.1 3374 CDS 100% 5.625 3.938 N Avil n/a
2 TRCN0000090781 CCATGATAAAGCCTGCAGTTT pLKO.1 1712 CDS 100% 4.950 3.465 N Avil n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11537 pDONR223 100% 82.9% 84.6% None (many diffs) n/a
2 ccsbBroad304_11537 pLX_304 0% 82.9% 84.6% V5 (many diffs) n/a
3 TRCN0000478506 ACACGAGAGACGTAACAAGATACC pLX_317 13.4% 82.9% 84.6% V5 (many diffs) n/a
4 TRCN0000465646 TTCTAAGGCGATGGCTCCTTCTAA pLX_317 10.3% 40.2% 39.3% V5 (many diffs) n/a
5 ccsbBroadEn_14524 pDONR223 100% 40.2% 39.3% None (many diffs) n/a
6 ccsbBroad304_14524 pLX_304 0% 40.2% 39.3% V5 (many diffs) n/a
Download CSV