Transcript: Mouse XM_006513761.1

PREDICTED: Mus musculus zinc finger, DHHC domain containing 17 (Zdhhc17), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc17 (320150)
Length:
4111
CDS:
355..1497

Additional Resources:

NCBI RefSeq record:
XM_006513761.1
NBCI Gene record:
Zdhhc17 (320150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125109 CCGAGGATAAATGTCGTTATA pLKO.1 1828 3UTR 100% 13.200 18.480 N Zdhhc17 n/a
2 TRCN0000125112 CCAGATAACATGTTTAGGTAT pLKO.1 1260 CDS 100% 4.950 6.930 N Zdhhc17 n/a
3 TRCN0000125113 CCTTTAATGTGGGCAGCTTAT pLKO.1 67 5UTR 100% 10.800 7.560 N Zdhhc17 n/a
4 TRCN0000125110 CCCTTTAATGTGGGCAGCTTA pLKO.1 66 5UTR 100% 4.950 3.465 N Zdhhc17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02758 pDONR223 100% 54.5% 58.7% None (many diffs) n/a
2 ccsbBroad304_02758 pLX_304 0% 54.5% 58.7% V5 (many diffs) n/a
3 TRCN0000478337 GCGGGATGTCCACCTATTATAATA pLX_317 16.6% 54.5% 58.7% V5 (many diffs) n/a
Download CSV