Transcript: Mouse XM_006514622.1

PREDICTED: Mus musculus cerebral cavernous malformation 2 (Ccm2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccm2 (216527)
Length:
1848
CDS:
105..1448

Additional Resources:

NCBI RefSeq record:
XM_006514622.1
NBCI Gene record:
Ccm2 (216527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197894 GTCGCCATTTAAACGAGTATT pLKO.1 128 CDS 100% 13.200 18.480 N Ccm2 n/a
2 TRCN0000083237 GCTGAGCGACTATATTGAGAA pLKO.1 260 CDS 100% 4.950 6.930 N CCM2 n/a
3 TRCN0000198459 GCTGAGCGACTATATTGAGAA pLKO.1 260 CDS 100% 4.950 6.930 N Ccm2 n/a
4 TRCN0000198373 GACATGAAGGACAGTTACGAT pLKO.1 852 CDS 100% 3.000 2.400 N Ccm2 n/a
5 TRCN0000199002 GCAGAAACCTCTGTGCCTATT pLKO.1 1636 3UTR 100% 10.800 7.560 N Ccm2 n/a
6 TRCN0000177414 GCATGATTTCAGACATCAGTA pLKO.1 1381 CDS 100% 4.950 3.465 N Ccm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04281 pDONR223 100% 86.8% 91.1% None (many diffs) n/a
2 ccsbBroad304_04281 pLX_304 0% 86.8% 91.1% V5 (many diffs) n/a
3 TRCN0000469977 AAGTACGCAATTACATCCAACGAA pLX_317 25.2% 86.8% 91.1% V5 (many diffs) n/a
4 ccsbBroadEn_12745 pDONR223 100% 13.7% 13.2% None (many diffs) n/a
5 ccsbBroad304_12745 pLX_304 0% 13.7% 13.2% V5 (many diffs) n/a
6 TRCN0000470550 AGCGCGAAGTGTATTCCTACTCGG pLX_317 100% 13.7% 13.2% V5 (many diffs) n/a
Download CSV