Transcript: Mouse XM_006515026.3

PREDICTED: Mus musculus intersectin 2 (Itsn2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itsn2 (20403)
Length:
7060
CDS:
227..3769

Additional Resources:

NCBI RefSeq record:
XM_006515026.3
NBCI Gene record:
Itsn2 (20403)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382401 CAAACTCAGCTAGCTACTATT pLKO_005 1064 CDS 100% 13.200 18.480 N Itsn2 n/a
2 TRCN0000381459 GGCCCAGTCTCTGATTGATTT pLKO_005 850 CDS 100% 13.200 18.480 N Itsn2 n/a
3 TRCN0000379869 ACCCGAGATCGCTCAAGTAAC pLKO_005 3352 CDS 100% 10.800 15.120 N Itsn2 n/a
4 TRCN0000382073 TTGCGCCAGGACAGTTAATAT pLKO_005 3411 CDS 100% 15.000 12.000 N Itsn2 n/a
5 TRCN0000111753 CCCTATGTTCTCTCCACTAAT pLKO.1 544 CDS 100% 13.200 10.560 N Itsn2 n/a
6 TRCN0000329058 TCCAAAGGACAGCTGATTAAT pLKO_005 3635 CDS 100% 15.000 10.500 N Itsn2 n/a
7 TRCN0000375264 TCCCTGAGAAGCAGCTATTAA pLKO_005 1893 CDS 100% 15.000 10.500 N Itsn2 n/a
8 TRCN0000328998 GCCAAATATGTGGGCTATTAC pLKO_005 262 CDS 100% 13.200 9.240 N Itsn2 n/a
9 TRCN0000111754 CCTGGAAATTATGGAAATCAA pLKO.1 1822 CDS 100% 5.625 3.938 N Itsn2 n/a
10 TRCN0000111751 CGCTCAAGTAACTTCAGCATA pLKO.1 3361 CDS 100% 4.950 3.465 N Itsn2 n/a
11 TRCN0000111752 GCAGACTACAAGATGTCCAAA pLKO.1 1749 CDS 100% 4.950 3.465 N Itsn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10457 pDONR223 100% 59.8% 62.2% None (many diffs) n/a
2 ccsbBroad304_10457 pLX_304 0% 59.8% 62.2% V5 (many diffs) n/a
3 TRCN0000481239 TCCCATTTCGAGTAAGGGAGCATT pLX_317 7.4% 59.8% 62.2% V5 (many diffs) n/a
Download CSV