Transcript: Mouse XM_006515128.3

PREDICTED: Mus musculus ataxin 7-like 1 (Atxn7l1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atxn7l1 (380753)
Length:
2946
CDS:
138..2729

Additional Resources:

NCBI RefSeq record:
XM_006515128.3
NBCI Gene record:
Atxn7l1 (380753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216935 CCTTTAGTCCTCACAACAAAC pLKO.1 2773 3UTR 100% 10.800 15.120 N Atxn7l1 n/a
2 TRCN0000180160 CGACGAATCTCCAAGTAACAA pLKO.1 2030 CDS 100% 5.625 7.875 N Atxn7l1 n/a
3 TRCN0000178764 CGAGGATACTATGTGTTTGAT pLKO.1 1548 CDS 100% 5.625 7.875 N Atxn7l1 n/a
4 TRCN0000105007 TCCGACAATGTAGATTTAGAA pLKO.1 312 CDS 100% 5.625 7.875 N Atxn7l1 n/a
5 TRCN0000348933 GGAGGTTATGAGGCTTAATAA pLKO_005 362 CDS 100% 15.000 12.000 N Atxn7l1 n/a
6 TRCN0000348871 TTCACCAGAGAAGATCTTAAA pLKO_005 884 CDS 100% 13.200 10.560 N Atxn7l1 n/a
7 TRCN0000376062 ATCGTCTGCAAACAGCATAAG pLKO_005 1328 CDS 100% 10.800 8.640 N Atxn7l1 n/a
8 TRCN0000376123 AGCACCTCAAAGCCATTTAAA pLKO_005 615 CDS 100% 15.000 10.500 N Atxn7l1 n/a
9 TRCN0000105006 AGGGAGGTTATGAGGCTTAAT pLKO.1 360 CDS 100% 13.200 9.240 N Atxn7l1 n/a
10 TRCN0000217153 CTTCACCAGAGAAGATCTTAA pLKO.1 883 CDS 100% 13.200 9.240 N Atxn7l1 n/a
11 TRCN0000348932 TGCTGAGCACTTTACAGTAAT pLKO_005 2747 3UTR 100% 13.200 9.240 N Atxn7l1 n/a
12 TRCN0000363855 ATAGAAGGTGGGATCGATTTC pLKO_005 1567 CDS 100% 10.800 7.560 N Atxn7l1 n/a
13 TRCN0000217719 GATAGAAGGTGGGATCGATTT pLKO.1 1566 CDS 100% 10.800 7.560 N Atxn7l1 n/a
14 TRCN0000180185 CGAGAAGTTAGACTGTCAGTT pLKO.1 1469 CDS 100% 4.950 3.465 N Atxn7l1 n/a
15 TRCN0000105008 CAAATTACACTGCTCCGACAA pLKO.1 299 CDS 100% 4.050 2.835 N Atxn7l1 n/a
16 TRCN0000135765 CAAATTACACTGCTCCGACAA pLKO.1 299 CDS 100% 4.050 2.835 N ATXN7L1 n/a
17 TRCN0000138057 CAGGGAGGTTATGAGGCTTAA pLKO.1 359 CDS 100% 10.800 6.480 N ATXN7L1 n/a
18 TRCN0000105009 CCAGCACATGATGACTTCTAT pLKO.1 411 CDS 100% 5.625 3.375 N Atxn7l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13436 pDONR223 100% 40.5% 40.3% None (many diffs) n/a
2 ccsbBroad304_13436 pLX_304 0% 40.5% 40.3% V5 (many diffs) n/a
3 TRCN0000474251 TGACTGAAATGCCAATCCTTACAA pLX_317 30.6% 40.5% 40.3% V5 (many diffs) n/a
4 ccsbBroadEn_05270 pDONR223 100% 15.6% 14% None (many diffs) n/a
5 ccsbBroad304_05270 pLX_304 0% 15.6% 14% V5 (many diffs) n/a
6 TRCN0000467830 CACTTATTGTTCCCGTGCCTCGCA pLX_317 66.5% 15.6% 14% V5 (many diffs) n/a
Download CSV