Transcript: Mouse XM_006515820.3

PREDICTED: Mus musculus YY1 transcription factor (Yy1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Yy1 (22632)
Length:
1270
CDS:
145..1143

Additional Resources:

NCBI RefSeq record:
XM_006515820.3
NBCI Gene record:
Yy1 (22632)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054556 GTGGTTGAAGAGCAGATCATT pLKO.1 853 CDS 100% 5.625 3.938 N Yy1 n/a
2 TRCN0000349352 GTGGTTGAAGAGCAGATCATT pLKO_005 853 CDS 100% 5.625 3.938 N Yy1 n/a
3 TRCN0000054554 CCCTAAGCAACTGGCAGAATT pLKO.1 960 CDS 100% 0.000 0.000 N Yy1 n/a
4 TRCN0000311794 CCCTAAGCAACTGGCAGAATT pLKO_005 960 CDS 100% 0.000 0.000 N Yy1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07141 pDONR223 100% 72% 71.3% None (many diffs) n/a
2 ccsbBroad304_07141 pLX_304 45.8% 72% 71.3% V5 (many diffs) n/a
3 TRCN0000480857 GTGCCCTAGATTAAACAACGATTT pLX_317 37.3% 72% 71.3% V5 (many diffs) n/a
Download CSV