Transcript: Mouse XM_006515841.3

PREDICTED: Mus musculus synaptotagmin XVI (Syt16), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syt16 (238266)
Length:
2803
CDS:
234..1838

Additional Resources:

NCBI RefSeq record:
XM_006515841.3
NBCI Gene record:
Syt16 (238266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515841.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381316 ATGCCACAACAGGGCGATTAT pLKO_005 1447 CDS 100% 13.200 18.480 N Syt16 n/a
2 TRCN0000093521 AGGGCGATTATCTGTGGAAAT pLKO.1 1457 CDS 100% 10.800 15.120 N Syt16 n/a
3 TRCN0000379542 AGATTTCAAAGGAGCTATAAA pLKO_005 2144 3UTR 100% 15.000 10.500 N Syt16 n/a
4 TRCN0000093523 GCGCACTATGAAGCGTAAAGA pLKO.1 1694 CDS 100% 5.625 3.938 N Syt16 n/a
5 TRCN0000093520 CCTGTCTATAAAGAGACCTTT pLKO.1 1611 CDS 100% 4.950 3.465 N Syt16 n/a
6 TRCN0000093522 CGTCACCTTGATGATTTCCAT pLKO.1 1664 CDS 100% 3.000 2.100 N Syt16 n/a
7 TRCN0000093519 GCACCCAAAGAAGAAGAGGAA pLKO.1 2555 3UTR 100% 2.640 1.848 N Syt16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515841.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12755 pDONR223 100% 34.2% 35.3% None (many diffs) n/a
2 ccsbBroad304_12755 pLX_304 0% 34.2% 35.3% V5 (many diffs) n/a
3 TRCN0000479179 GACCTTACCGCCTCTGTGCTATGT pLX_317 77.2% 34.2% 35.3% V5 (many diffs) n/a
Download CSV