Transcript: Mouse XM_006516054.3

PREDICTED: Mus musculus mitogen-activated protein kinase kinase kinase kinase 5 (Map4k5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map4k5 (399510)
Length:
4458
CDS:
411..2951

Additional Resources:

NCBI RefSeq record:
XM_006516054.3
NBCI Gene record:
Map4k5 (399510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516054.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025197 CTTGCCTACTTGCATACTAAA pLKO.1 792 CDS 100% 13.200 18.480 N Map4k5 n/a
2 TRCN0000025195 CCCACGCAATCATTCGTCATA pLKO.1 1348 CDS 100% 4.950 6.930 N Map4k5 n/a
3 TRCN0000435391 TCTACTCTCACAACCTTATTG pLKO_005 2134 CDS 100% 13.200 10.560 N Map4k5 n/a
4 TRCN0000025198 GCAACTATGGAACAGTTATTT pLKO.1 2043 CDS 100% 15.000 10.500 N Map4k5 n/a
5 TRCN0000362467 TGGAACTGAAGATGGTATTTA pLKO_005 1994 CDS 100% 15.000 10.500 N Map4k5 n/a
6 TRCN0000362466 TCACGTGACTGGGCCATTATC pLKO_005 728 CDS 100% 13.200 9.240 N Map4k5 n/a
7 TRCN0000362468 GCTGGAAACAGCTAGTCAATC pLKO_005 3119 3UTR 100% 10.800 7.560 N Map4k5 n/a
8 TRCN0000362469 GTGGTGGTTATATCAAGTTTG pLKO_005 3152 3UTR 100% 10.800 7.560 N Map4k5 n/a
9 TRCN0000025194 GCTTCAAATCAGATGAGGTTA pLKO.1 2791 CDS 100% 4.950 3.465 N Map4k5 n/a
10 TRCN0000025196 GCTGCATAGTTAGAAACCCTT pLKO.1 2284 CDS 100% 2.640 1.848 N Map4k5 n/a
11 TRCN0000197245 GCCACTGTGTGGTGGTTATAT pLKO.1 3144 3UTR 100% 15.000 9.000 N MAP4K5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516054.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14987 pDONR223 0% 89.2% 95.9% None (many diffs) n/a
2 ccsbBroad304_14987 pLX_304 0% 89.2% 95.9% V5 (many diffs) n/a
3 TRCN0000481402 CAGCAATATACCGATGTCGAACGT pLX_317 16.1% 89.2% 95.9% V5 (many diffs) n/a
4 TRCN0000489738 ACGTTCGTAGTTTCTTTTAGTTTC pLX_317 15.9% 89.2% 95.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV