Transcript: Mouse XM_006516079.3

PREDICTED: Mus musculus SET domain containing 3 (Setd3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Setd3 (52690)
Length:
2714
CDS:
276..2081

Additional Resources:

NCBI RefSeq record:
XM_006516079.3
NBCI Gene record:
Setd3 (52690)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276530 GATGTCTTCAGCCAGTATAAA pLKO_005 909 CDS 100% 15.000 12.000 N SETD3 n/a
2 TRCN0000174341 CGAAAGTTACTAATGACTGTT pLKO.1 669 CDS 100% 4.950 3.960 N Setd3 n/a
3 TRCN0000193723 CATCACCATGTTCCTTGTTAA pLKO.1 2128 3UTR 100% 13.200 9.240 N Setd3 n/a
4 TRCN0000175757 GAGGTCAAACTTTGGACATTT pLKO.1 1563 CDS 100% 13.200 9.240 N Setd3 n/a
5 TRCN0000175684 GCTGGAGATCAGATTTACATT pLKO.1 1209 CDS 100% 5.625 3.938 N Setd3 n/a
6 TRCN0000143640 GCTTTGGTTTGAGAGCAACAA pLKO.1 610 CDS 100% 4.950 3.465 N SETD3 n/a
7 TRCN0000276531 GCTTTGGTTTGAGAGCAACAA pLKO_005 610 CDS 100% 4.950 3.465 N SETD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12791 pDONR223 100% 44.3% 46.5% None (many diffs) n/a
2 ccsbBroad304_12791 pLX_304 0% 44.3% 46.5% V5 (many diffs) n/a
3 TRCN0000469827 TGTCACCAGTCCGACCCCCCACAC pLX_317 46.3% 44.3% 46.5% V5 (many diffs) n/a
4 ccsbBroadEn_12790 pDONR223 100% 32.3% 33.6% None (many diffs) n/a
5 ccsbBroad304_12790 pLX_304 0% 32.3% 33.6% V5 (many diffs) n/a
6 TRCN0000474620 GCGGACCCCCACCCACACATATAC pLX_317 38.6% 32.3% 33.6% V5 (many diffs) n/a
Download CSV