Transcript: Mouse XM_006516275.3

PREDICTED: Mus musculus ribosomal protein S6 kinase, polypeptide 5 (Rps6ka5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rps6ka5 (73086)
Length:
4506
CDS:
516..2840

Additional Resources:

NCBI RefSeq record:
XM_006516275.3
NBCI Gene record:
Rps6ka5 (73086)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378423 ATCTGCCTCGTGACGAATATT pLKO_005 2921 3UTR 100% 15.000 21.000 N Rps6ka5 n/a
2 TRCN0000079080 GCTTCATCTCATCTTAGATTA pLKO.1 818 CDS 100% 13.200 18.480 N Rps6ka5 n/a
3 TRCN0000361865 GGATTATATACCGTGACATTA pLKO_005 955 CDS 100% 13.200 18.480 N Rps6ka5 n/a
4 TRCN0000361864 TCATGCCTTTAACAAGTATAA pLKO_005 2597 CDS 100% 13.200 9.240 N Rps6ka5 n/a
5 TRCN0000378413 AGCACGAAGTGCAGATCTATG pLKO_005 892 CDS 100% 10.800 7.560 N Rps6ka5 n/a
6 TRCN0000079081 CCCAATATTGTGAAACTACAT pLKO.1 1875 CDS 100% 4.950 3.465 N Rps6ka5 n/a
7 TRCN0000079079 GCGTGGAAGAATGTATCCCAA pLKO.1 2394 CDS 100% 2.640 1.848 N Rps6ka5 n/a
8 TRCN0000079078 CGAGGGAAAGTAAAGGGAATT pLKO.1 3731 3UTR 100% 0.000 0.000 N Rps6ka5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02123 pDONR223 100% 59.5% 63.5% None (many diffs) n/a
2 ccsbBroad304_02123 pLX_304 0% 59.5% 63.5% V5 (many diffs) n/a
3 TRCN0000466446 TCTTTACTTTACGTCATCATTACA pLX_317 26.9% 59.5% 63.5% V5 (many diffs) n/a
4 ccsbBroadEn_14934 pDONR223 0% 59.5% 63.5% None (many diffs) n/a
5 ccsbBroad304_14934 pLX_304 0% 59.5% 63.5% V5 (many diffs) n/a
6 TRCN0000480681 TACACAATAACACTCCCGACAATC pLX_317 26.9% 59.5% 63.5% V5 (many diffs) n/a
Download CSV