Transcript: Mouse XM_006516436.2

PREDICTED: Mus musculus predicted gene, 21936 (Gm21936), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm21936 (100861898)
Length:
447
CDS:
13..447

Additional Resources:

NCBI RefSeq record:
XM_006516436.2
NBCI Gene record:
Gm21936 (100861898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136727 GACACATTTGGTCCTGGAGAT pLKO.1 367 CDS 100% 4.050 2.430 N EIF1AY n/a
2 TRCN0000256193 AGATAACAAAGCTGATGTAAT pLKO_005 267 CDS 100% 13.200 6.600 Y Gm2016 n/a
3 TRCN0000256191 TAAGGAGGCTGTGCCACATAA pLKO_005 176 CDS 100% 13.200 6.600 Y Gm2016 n/a
4 TRCN0000270211 TGAAATCGTGTTTGATGATAT pLKO_005 393 CDS 100% 13.200 6.600 Y Gm5662 n/a
5 TRCN0000256195 ATGATGATGAAATCGTGTTTG pLKO_005 386 CDS 100% 10.800 5.400 Y Gm2016 n/a
6 TRCN0000270258 CCTCAGACATTATATTGATTG pLKO_005 230 CDS 100% 10.800 5.400 Y Gm5662 n/a
7 TRCN0000127030 CGAGACTATCAAGATAACAAA pLKO.1 256 CDS 100% 5.625 2.813 Y Eif1a n/a
8 TRCN0000334581 CGAGACTATCAAGATAACAAA pLKO_005 256 CDS 100% 5.625 2.813 Y Eif1a n/a
9 TRCN0000135663 GTCCTGGAGATGATGATGAAA pLKO.1 377 CDS 100% 5.625 2.813 Y EIF1AY n/a
10 TRCN0000062621 CCTGGAGATGATGATGAAATT pLKO.1 379 CDS 100% 13.200 6.600 Y EIF1AX n/a
11 TRCN0000299509 CCTGGAGATGATGATGAAATT pLKO_005 379 CDS 100% 13.200 6.600 Y EIF1AX n/a
12 TRCN0000256192 CATTATATTGATTGGTCTAAG pLKO_005 237 CDS 100% 10.800 5.400 Y Gm2016 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02077 pDONR223 100% 89.3% 90.9% None (many diffs) n/a
2 ccsbBroad304_02077 pLX_304 0% 89.3% 90.9% V5 (many diffs) n/a
3 TRCN0000466671 CTTCCACCAGTTATAATCCAACTC pLX_317 57.7% 89.3% 90.9% V5 (many diffs) n/a
4 ccsbBroadEn_06145 pDONR223 100% 86.1% 90.9% None (many diffs) n/a
5 ccsbBroad304_06145 pLX_304 0% 86.1% 90.9% V5 (many diffs) n/a
6 TRCN0000475064 CCTGTTCTTTCTGAACACCACATC pLX_317 100% 86.1% 90.9% V5 (many diffs) n/a
Download CSV