Transcript: Mouse XM_006516502.3

PREDICTED: Mus musculus zinc finger, MYND domain containing 11 (Zmynd11), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zmynd11 (66505)
Length:
3732
CDS:
263..2116

Additional Resources:

NCBI RefSeq record:
XM_006516502.3
NBCI Gene record:
Zmynd11 (66505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319415 TTGCCAACATTGATCGTATTA pLKO_005 354 CDS 100% 13.200 18.480 N Zmynd11 n/a
2 TRCN0000376908 TGGAGGGTACTACTCTAAATA pLKO_005 2293 3UTR 100% 15.000 10.500 N Zmynd11 n/a
3 TRCN0000021253 CCCAGTTTGCAGGAGCATTAA pLKO.1 733 CDS 100% 13.200 9.240 N ZMYND11 n/a
4 TRCN0000275478 CCCAGTTTGCAGGAGCATTAA pLKO_005 733 CDS 100% 13.200 9.240 N ZMYND11 n/a
5 TRCN0000350057 CGGACATTGCACGGATGTTAT pLKO_005 1020 CDS 100% 13.200 9.240 N Zmynd11 n/a
6 TRCN0000319412 CTGGCGGCATGTGATTGAATA pLKO_005 2559 3UTR 100% 13.200 9.240 N Zmynd11 n/a
7 TRCN0000088135 GCTGTGAAAGATGGTCTTATT pLKO.1 437 CDS 100% 13.200 9.240 N Zmynd11 n/a
8 TRCN0000088136 GCAAAGAAAGGACGACGTAAT pLKO.1 1490 CDS 100% 10.800 7.560 N Zmynd11 n/a
9 TRCN0000088137 GCACTCTAACAAGCAGGAAAT pLKO.1 760 CDS 100% 10.800 7.560 N Zmynd11 n/a
10 TRCN0000317604 GCACTCTAACAAGCAGGAAAT pLKO_005 760 CDS 100% 10.800 7.560 N Zmynd11 n/a
11 TRCN0000088134 CCAAGAAGTTAAGTGCCTCTT pLKO.1 1626 CDS 100% 4.050 2.835 N Zmynd11 n/a
12 TRCN0000088133 CCGTTCCTTGTATTAAAGATA pLKO.1 3047 3UTR 100% 5.625 7.875 N Zmynd11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11547 pDONR223 100% 76.3% 82.6% None (many diffs) n/a
2 ccsbBroad304_11547 pLX_304 0% 76.3% 82.6% V5 (many diffs) n/a
3 TRCN0000479986 CACCGGTCCGCCGCCTTCCTTCTT pLX_317 25.1% 76.3% 82.6% V5 (many diffs) n/a
Download CSV