Transcript: Mouse XM_006516519.1

PREDICTED: Mus musculus dual specificity phosphatase 22 (Dusp22), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dusp22 (105352)
Length:
3061
CDS:
81..689

Additional Resources:

NCBI RefSeq record:
XM_006516519.1
NBCI Gene record:
Dusp22 (105352)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081343 CCTGTCTGTTTCGTAATAGTA pLKO.1 2844 3UTR 100% 5.625 7.875 N Dusp22 n/a
2 TRCN0000317270 CCTGTCTGTTTCGTAATAGTA pLKO_005 2844 3UTR 100% 5.625 7.875 N Dusp22 n/a
3 TRCN0000081344 CCCATGTTGGAGGGAGTTAAA pLKO.1 198 CDS 100% 13.200 10.560 N Dusp22 n/a
4 TRCN0000317269 CCCATGTTGGAGGGAGTTAAA pLKO_005 198 CDS 100% 13.200 10.560 N Dusp22 n/a
5 TRCN0000081346 CCATGTTGGAGGGAGTTAAAT pLKO.1 199 CDS 100% 15.000 10.500 N Dusp22 n/a
6 TRCN0000081347 AGGAACAAGGTGACACACATT pLKO.1 153 CDS 100% 4.950 3.465 N Dusp22 n/a
7 TRCN0000317195 AGGAACAAGGTGACACACATT pLKO_005 153 CDS 100% 4.950 3.465 N Dusp22 n/a
8 TRCN0000081345 CAGGAGTTTGAGAAACATGAA pLKO.1 477 CDS 100% 4.950 3.465 N Dusp22 n/a
9 TRCN0000349514 CAGGAGTTTGAGAAACATGAA pLKO_005 477 CDS 100% 4.950 3.465 N Dusp22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491693 CTTAATGCTCTTTTTAATCCTTGT pLX_317 56.9% 74.7% 74.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_03758 pDONR223 100% 74.2% 74.7% None (many diffs) n/a
3 ccsbBroad304_03758 pLX_304 0% 74.2% 74.7% V5 (many diffs) n/a
4 TRCN0000471126 AGGGGACACCACATGGATCACCAT pLX_317 75% 74.2% 74.7% V5 (many diffs) n/a
Download CSV