Transcript: Mouse XM_006516589.3

PREDICTED: Mus musculus family with sequence similarity 65, member B (Fam65b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ripor2 (193385)
Length:
5402
CDS:
72..3281

Additional Resources:

NCBI RefSeq record:
XM_006516589.3
NBCI Gene record:
Ripor2 (193385)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215997 CAAATTGACTGCTCAATTAAA pLKO.1 464 CDS 100% 1.500 1.200 N Ripor2 n/a
2 TRCN0000283095 CCAGACGGAGCTGGACAAATT pLKO_005 449 CDS 100% 13.200 9.240 N Ripor2 n/a
3 TRCN0000264595 CCCTCATAGTTGGGTTCATTT pLKO_005 889 CDS 100% 13.200 9.240 N Ripor2 n/a
4 TRCN0000192638 GAACCAAGAAGTCACTCACTT pLKO.1 1955 CDS 100% 4.950 3.465 N Ripor2 n/a
5 TRCN0000190575 GCCTTCAATGGACTCTTCCTT pLKO.1 1890 CDS 100% 3.000 2.100 N Ripor2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467274 GGGGGAGTGATTCTGGCAACTAAG pLX_317 24.3% 43.8% 45.2% V5 (many diffs) n/a
2 ccsbBroadEn_07481 pDONR223 100% 43.8% 45.1% None (many diffs) n/a
3 ccsbBroad304_07481 pLX_304 0% 43.8% 45.1% V5 (many diffs) n/a
Download CSV