Transcript: Mouse XM_006516903.3

PREDICTED: Mus musculus transcription factor AP-2, alpha (Tfap2a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfap2a (21418)
Length:
3326
CDS:
242..1513

Additional Resources:

NCBI RefSeq record:
XM_006516903.3
NBCI Gene record:
Tfap2a (21418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321210 ACGTAGAAGACCCGGGTATTA pLKO_005 681 CDS 100% 13.200 18.480 N Tfap2a n/a
2 TRCN0000321153 GCAAAGAGGATAATGACATTT pLKO_005 1982 3UTR 100% 13.200 18.480 N Tfap2a n/a
3 TRCN0000004923 CCGGGTATTAACATCCCAGAT pLKO.1 692 CDS 100% 4.050 5.670 N TFAP2A n/a
4 TRCN0000012050 CGGAGAGCGAAGTCTAAGAAT pLKO.1 959 CDS 100% 5.625 4.500 N Tfap2a n/a
5 TRCN0000012051 GAGTTGCTTGACCCACTTCAA pLKO.1 1318 CDS 100% 4.950 3.960 N Tfap2a n/a
6 TRCN0000321143 GAGTTGCTTGACCCACTTCAA pLKO_005 1318 CDS 100% 4.950 3.960 N Tfap2a n/a
7 TRCN0000004925 CCCAGATCAAACTGTAATTAA pLKO.1 706 CDS 100% 15.000 10.500 N TFAP2A n/a
8 TRCN0000272665 CCCAGATCAAACTGTAATTAA pLKO_005 706 CDS 100% 15.000 10.500 N TFAP2A n/a
9 TRCN0000321211 TGTCTCCGCCATCCCTATTAA pLKO_005 766 CDS 100% 15.000 10.500 N Tfap2a n/a
10 TRCN0000012049 GCAGAATTTCTCAACCGACAA pLKO.1 1151 CDS 100% 4.050 2.835 N Tfap2a n/a
11 TRCN0000321209 GCAGAATTTCTCAACCGACAA pLKO_005 1151 CDS 100% 4.050 2.835 N Tfap2a n/a
12 TRCN0000012052 CGAAACTGAATTTCCTGCCAA pLKO.1 1123 CDS 100% 2.640 1.848 N Tfap2a n/a
13 TRCN0000012048 CCGCTGCCTACTCAGCGCCTT pLKO.1 1698 3UTR 100% 0.000 0.000 N Tfap2a n/a
14 TRCN0000272680 TCAGATTGTAGCCATACTTAA pLKO_005 1951 3UTR 100% 13.200 18.480 N TFAP2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07050 pDONR223 100% 92.5% 96.7% None (many diffs) n/a
2 ccsbBroad304_07050 pLX_304 0% 92.5% 96.7% V5 (many diffs) n/a
3 TRCN0000481607 GAGGAAGGTATGTCTCAAGAGCCT pLX_317 37.3% 92.5% 96.7% V5 (many diffs) n/a
Download CSV