Transcript: Mouse XM_006517099.2

PREDICTED: Mus musculus fibroblast growth factor receptor 4 (Fgfr4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fgfr4 (14186)
Length:
3042
CDS:
368..2458

Additional Resources:

NCBI RefSeq record:
XM_006517099.2
NBCI Gene record:
Fgfr4 (14186)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023566 CGTCGTACACAATCTTACGTT pLKO.1 373 CDS 100% 3.000 4.200 N Fgfr4 n/a
2 TRCN0000280547 CGTCGTACACAATCTTACGTT pLKO_005 373 CDS 100% 3.000 4.200 N Fgfr4 n/a
3 TRCN0000023568 CTGCCGGGAATACTGTCAAAT pLKO.1 537 CDS 100% 13.200 9.240 N Fgfr4 n/a
4 TRCN0000023564 CCTGAAGACAACAGACATCAA pLKO.1 961 CDS 100% 4.950 3.465 N Fgfr4 n/a
5 TRCN0000280484 CCTGAAGACAACAGACATCAA pLKO_005 961 CDS 100% 4.950 3.465 N Fgfr4 n/a
6 TRCN0000023567 GCTAATCGGAAGACACAAGAA pLKO.1 1624 CDS 100% 4.950 3.465 N Fgfr4 n/a
7 TRCN0000280483 GCTAATCGGAAGACACAAGAA pLKO_005 1624 CDS 100% 4.950 3.465 N Fgfr4 n/a
8 TRCN0000023565 GCTGTCTCTGAAGAGTACCTT pLKO.1 2294 CDS 100% 3.000 2.100 N Fgfr4 n/a
9 TRCN0000297859 GCTGTCTCTGAAGAGTACCTT pLKO_005 2294 CDS 100% 3.000 2.100 N Fgfr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488483 TATTCCTGCATCTCCATCTGAAAC pLX_317 14.6% 74.4% 78.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491479 CGCCAGACTGTCTGACGGCAGATA pLX_317 23.9% 50% 1.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV