Transcript: Mouse XM_006517172.3

PREDICTED: Mus musculus solute carrier family 12, member 7 (Slc12a7), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc12a7 (20499)
Length:
3927
CDS:
443..3709

Additional Resources:

NCBI RefSeq record:
XM_006517172.3
NBCI Gene record:
Slc12a7 (20499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000351058 AGGTGTAGTCCTGCGAGATAA pLKO_005 1876 CDS 100% 13.200 9.240 N Slc12a7 n/a
2 TRCN0000068368 CGTGACTACATCTTTCATTTA pLKO.1 1819 CDS 100% 13.200 9.240 N Slc12a7 n/a
3 TRCN0000327500 CGTGACTACATCTTTCATTTA pLKO_005 1819 CDS 100% 13.200 9.240 N Slc12a7 n/a
4 TRCN0000068372 GCTTGGAAGGAGGCAGATAAT pLKO.1 2834 CDS 100% 13.200 9.240 N Slc12a7 n/a
5 TRCN0000379346 TGAACAAGCTGGCCAACTATA pLKO_005 699 CDS 100% 13.200 9.240 N Slc12a7 n/a
6 TRCN0000068369 CGGCTGCATCTACAAGTACAT pLKO.1 2377 CDS 100% 4.950 3.465 N Slc12a7 n/a
7 TRCN0000363561 CGGCTGCATCTACAAGTACAT pLKO_005 2377 CDS 100% 4.950 3.465 N Slc12a7 n/a
8 TRCN0000068370 GCATCTACTTCCCGTCTGTAA pLKO.1 1716 CDS 100% 4.950 3.465 N Slc12a7 n/a
9 TRCN0000068371 TGGACGAAAGAGAAACTCATT pLKO.1 3383 CDS 100% 4.950 2.970 N Slc12a7 n/a
10 TRCN0000327498 TGGACGAAAGAGAAACTCATT pLKO_005 3383 CDS 100% 4.950 2.970 N Slc12a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14053 pDONR223 100% 20.3% 19.4% None (many diffs) n/a
2 ccsbBroad304_14053 pLX_304 0% 20.3% 19.4% V5 (many diffs) n/a
3 TRCN0000466206 CTACACTCGTTGTGTCCGATGGTT pLX_317 42.2% 20.3% 19.4% V5 (many diffs) n/a
Download CSV