Transcript: Mouse XM_006517773.3

PREDICTED: Mus musculus GC-rich promoter binding protein 1 (Gpbp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpbp1 (73274)
Length:
3484
CDS:
1565..2671

Additional Resources:

NCBI RefSeq record:
XM_006517773.3
NBCI Gene record:
Gpbp1 (73274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071135 CCAAGTTATTAGTGAACAGTT pLKO.1 2494 CDS 100% 4.950 6.930 N Gpbp1 n/a
2 TRCN0000071136 CGACGACACAATTCTTCAGAT pLKO.1 1546 5UTR 100% 4.950 6.930 N Gpbp1 n/a
3 TRCN0000303107 CGACGACACAATTCTTCAGAT pLKO_005 1546 5UTR 100% 4.950 6.930 N Gpbp1 n/a
4 TRCN0000071134 GCTGGTCATTAAGAAAGGTAA pLKO.1 1765 CDS 100% 4.950 3.960 N Gpbp1 n/a
5 TRCN0000303110 GCTGGTCATTAAGAAAGGTAA pLKO_005 1765 CDS 100% 4.950 3.960 N Gpbp1 n/a
6 TRCN0000071137 GCAATACTACTCACCAAGAAA pLKO.1 2250 CDS 100% 5.625 3.938 N Gpbp1 n/a
7 TRCN0000303108 GCAATACTACTCACCAAGAAA pLKO_005 2250 CDS 100% 5.625 3.938 N Gpbp1 n/a
8 TRCN0000071133 GCATTTCTCTTGACTAGCAAT pLKO.1 2923 3UTR 100% 4.950 3.465 N Gpbp1 n/a
9 TRCN0000303109 GCATTTCTCTTGACTAGCAAT pLKO_005 2923 3UTR 100% 4.950 3.465 N Gpbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08887 pDONR223 100% 65.3% 63.6% None (many diffs) n/a
2 TRCN0000468929 GAGTAGAACAATCACTCTTTTACA pLX_317 32.3% 65.3% 63.6% V5 (many diffs) n/a
3 ccsbBroadEn_12509 pDONR223 100% 45.7% 47.8% None (many diffs) n/a
4 ccsbBroad304_12509 pLX_304 0% 45.7% 47.8% V5 (many diffs) n/a
5 TRCN0000479069 TTATCAGGCATCTTTTTACTTATT pLX_317 57.9% 45.7% 47.8% V5 (many diffs) n/a
Download CSV