Transcript: Mouse XM_006518432.3

PREDICTED: Mus musculus propionyl-Coenzyme A carboxylase, alpha polypeptide (Pcca), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcca (110821)
Length:
2437
CDS:
230..2164

Additional Resources:

NCBI RefSeq record:
XM_006518432.3
NBCI Gene record:
Pcca (110821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339215 ATTCAAGAGTACCAGTTATTA pLKO_005 1614 CDS 100% 15.000 21.000 N Pcca n/a
2 TRCN0000306131 ATCGATAACCCTCGTCATATA pLKO_005 767 CDS 100% 13.200 18.480 N Pcca n/a
3 TRCN0000339287 TCGATAACCCTCGTCATATAG pLKO_005 768 CDS 100% 13.200 18.480 N Pcca n/a
4 TRCN0000112468 CCCTACAAGTCTTTCGGTTTA pLKO.1 1190 CDS 100% 10.800 15.120 N Pcca n/a
5 TRCN0000306062 AGTGACATCAGCATCTATTAT pLKO_005 1292 CDS 100% 15.000 10.500 N Pcca n/a
6 TRCN0000078427 GCAGTTGAATGTCGGGTTTAT pLKO.1 1160 CDS 100% 13.200 9.240 N PCCA n/a
7 TRCN0000339286 GCAGTTGAATGTCGGGTTTAT pLKO_005 1160 CDS 100% 13.200 9.240 N Pcca n/a
8 TRCN0000112467 GCCTGGACTTAGTCCAAGAAA pLKO.1 1074 CDS 100% 5.625 3.938 N Pcca n/a
9 TRCN0000112465 CCTCCTGTTTATTCCTCAGAA pLKO.1 2283 3UTR 100% 4.950 3.465 N Pcca n/a
10 TRCN0000325845 CCTCCTGTTTATTCCTCAGAA pLKO_005 2283 3UTR 100% 4.950 3.465 N Pcca n/a
11 TRCN0000112466 CGAAACTAAATGTGACCAGTA pLKO.1 1740 CDS 100% 4.050 2.835 N Pcca n/a
12 TRCN0000112469 GTCACTTTCATTGGACCTGAT pLKO.1 458 CDS 100% 4.050 2.835 N Pcca n/a
13 TRCN0000325846 GTCACTTTCATTGGACCTGAT pLKO_005 458 CDS 100% 4.050 2.835 N Pcca n/a
14 TRCN0000078423 CGTCATATAGAAATCCAGGTT pLKO.1 779 CDS 100% 2.640 1.848 N PCCA n/a
15 TRCN0000078426 GCAGGTGGAAACATGAGCATT pLKO.1 1838 CDS 100% 4.950 3.465 N PCCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11018 pDONR223 100% 80.3% 84.6% None (many diffs) n/a
2 ccsbBroad304_11018 pLX_304 0% 80.3% 84.6% V5 (many diffs) n/a
3 TRCN0000477380 CACATGCGCCTAGGTGTCCATTCG pLX_317 21.2% 80.3% 84.6% V5 (many diffs) n/a
Download CSV