Transcript: Mouse XM_006518525.3

PREDICTED: Mus musculus dematin actin binding protein (Dmtn), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmtn (13829)
Length:
2759
CDS:
363..1637

Additional Resources:

NCBI RefSeq record:
XM_006518525.3
NBCI Gene record:
Dmtn (13829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108883 CATCATCGAATCCTCCAAGTT pLKO.1 917 CDS 100% 4.950 6.930 N Dmtn n/a
2 TRCN0000108884 CCTCATCATCGAATCCTCCAA pLKO.1 914 CDS 100% 2.640 3.696 N Dmtn n/a
3 TRCN0000152047 CAGTAAGGTTACTTCCAACTT pLKO.1 1142 CDS 100% 4.950 3.465 N DMTN n/a
4 TRCN0000108881 CCCGGATTCCAACATCTACAA pLKO.1 824 CDS 100% 4.950 3.465 N Dmtn n/a
5 TRCN0000151266 CAGAAGATCTATCCCTATGAA pLKO.1 1437 CDS 100% 5.625 3.938 N DMTN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00507 pDONR223 100% 85.9% 91.7% None (many diffs) n/a
2 ccsbBroadEn_13854 pDONR223 100% 80.8% .9% None (many diffs) n/a
3 ccsbBroad304_13854 pLX_304 0% 80.8% .9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000468736 ACTACCAGTTGTTTTGACAGCCCA pLX_317 34.4% 80.8% .9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV