Transcript: Mouse XM_006518957.3

PREDICTED: Mus musculus Rho GTPase activating protein 22 (Arhgap22), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap22 (239027)
Length:
3076
CDS:
580..2718

Additional Resources:

NCBI RefSeq record:
XM_006518957.3
NBCI Gene record:
Arhgap22 (239027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518957.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197662 CCACTCAGATGTCAATAAGAT pLKO.1 1515 CDS 100% 5.625 7.875 N Arhgap22 n/a
2 TRCN0000181968 CCCACTCAGATGTCAATAAGA pLKO.1 1514 CDS 100% 5.625 3.938 N Arhgap22 n/a
3 TRCN0000047205 CAGGGATTTATTTCTCTACAA pLKO.1 811 CDS 100% 4.950 3.465 N ARHGAP22 n/a
4 TRCN0000047203 GCTCAGATACATCTGCAAGTT pLKO.1 1476 CDS 100% 4.950 3.465 N ARHGAP22 n/a
5 TRCN0000177132 GCTCTTCTACTACAAAGACAA pLKO.1 774 CDS 100% 4.950 3.465 N Arhgap22 n/a
6 TRCN0000182081 CCACAGATAGAGGATCCAGTA pLKO.1 1582 CDS 100% 4.050 2.835 N Arhgap22 n/a
7 TRCN0000182379 GCATCTGATGACTGTCCTCAT pLKO.1 1632 CDS 100% 4.050 2.835 N Arhgap22 n/a
8 TRCN0000181601 GCTAAACAAGTGAGCAACCTT pLKO.1 1435 CDS 100% 3.000 2.100 N Arhgap22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518957.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08780 pDONR223 100% 79.4% 35.6% None (many diffs) n/a
2 ccsbBroad304_08780 pLX_304 0% 79.4% 35.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478424 GAGTTTAGGGGTTTCCTCCTTGGC pLX_317 13.6% 79.4% 35.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV