Transcript: Mouse XM_006519087.3

PREDICTED: Mus musculus DDB1 and CUL4 associated factor 11 (Dcaf11), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dcaf11 (28199)
Length:
3080
CDS:
869..2386

Additional Resources:

NCBI RefSeq record:
XM_006519087.3
NBCI Gene record:
Dcaf11 (28199)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519087.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336130 TCGCCTTGGAGATCGATATAA pLKO_005 991 CDS 100% 15.000 21.000 N Dcaf11 n/a
2 TRCN0000184531 GAGCGGCCACATTGTTAAGAA pLKO.1 2149 CDS 100% 5.625 7.875 N Dcaf11 n/a
3 TRCN0000336128 GAGCGGCCACATTGTTAAGAA pLKO_005 2149 CDS 100% 5.625 7.875 N Dcaf11 n/a
4 TRCN0000183114 CTGGTCTGACTACATTCATAT pLKO.1 1447 CDS 100% 13.200 9.240 N Dcaf11 n/a
5 TRCN0000336127 CTGGTCTGACTACATTCATAT pLKO_005 1447 CDS 100% 13.200 9.240 N Dcaf11 n/a
6 TRCN0000336129 AGGTCTGAATGGACCCATTAG pLKO_005 2718 3UTR 100% 10.800 7.560 N Dcaf11 n/a
7 TRCN0000184257 GATCAAGACACAGGTGGGATT pLKO.1 1060 CDS 100% 4.050 2.835 N Dcaf11 n/a
8 TRCN0000336187 GATCAAGACACAGGTGGGATT pLKO_005 1060 CDS 100% 4.050 2.835 N Dcaf11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519087.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09034 pDONR223 100% 81.8% 84.8% None (many diffs) n/a
2 ccsbBroad304_09034 pLX_304 0% 81.8% 84.8% V5 (many diffs) n/a
3 TRCN0000480254 TTTCTACCAGGTAGTATGAAGTAA pLX_317 19.9% 81.8% 84.8% V5 (many diffs) n/a
Download CSV