Transcript: Mouse XM_006519148.3

PREDICTED: Mus musculus component of oligomeric golgi complex 3 (Cog3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cog3 (338337)
Length:
2585
CDS:
139..2529

Additional Resources:

NCBI RefSeq record:
XM_006519148.3
NBCI Gene record:
Cog3 (338337)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065228 GCCAAGTTAGATGATTGTATA pLKO.1 817 CDS 100% 13.200 18.480 N COG3 n/a
2 TRCN0000175082 GCCAAGTTAGATGATTGTATA pLKO.1 817 CDS 100% 13.200 18.480 N Cog3 n/a
3 TRCN0000216960 CCTATGACTGTTCCACGATTT pLKO.1 2092 CDS 100% 10.800 15.120 N Cog3 n/a
4 TRCN0000248282 CCTATGACTGTTCCACGATTT pLKO_005 2092 CDS 100% 10.800 15.120 N Cog3 n/a
5 TRCN0000248285 TAATGAGTTGGAGACGATTAA pLKO_005 738 CDS 100% 13.200 10.560 N Cog3 n/a
6 TRCN0000248281 CCAAGATGAGCACCAACTTTA pLKO_005 1269 CDS 100% 13.200 9.240 N Cog3 n/a
7 TRCN0000175521 CCCTAAAGTCAGAACTCTAAT pLKO.1 1050 CDS 100% 13.200 9.240 N Cog3 n/a
8 TRCN0000248284 GACAATGCCTTCACACTATTT pLKO_005 1006 CDS 100% 13.200 9.240 N Cog3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12742 pDONR223 100% 50% 52.8% None (many diffs) n/a
2 ccsbBroad304_12742 pLX_304 0% 50% 52.8% V5 (many diffs) n/a
3 TRCN0000469829 GACATGATCCGTATTAACAAGGGA pLX_317 35.7% 50% 52.8% V5 (many diffs) n/a
Download CSV