Transcript: Mouse XM_006519325.3

PREDICTED: Mus musculus leukotriene B4 receptor 2 (Ltb4r2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ltb4r2 (57260)
Length:
2455
CDS:
277..1395

Additional Resources:

NCBI RefSeq record:
XM_006519325.3
NBCI Gene record:
Ltb4r2 (57260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027884 TCGGTTCCTTACTCGACTCTT pLKO.1 1215 CDS 100% 4.950 6.930 N Ltb4r2 n/a
2 TRCN0000451680 CCACGCGGTCAATCTCCTACA pLKO_005 1032 CDS 100% 1.350 1.890 N Ltb4r2 n/a
3 TRCN0000449820 TACTCCTAAGCTGAAAGTAAT pLKO_005 1299 CDS 100% 13.200 9.240 N Ltb4r2 n/a
4 TRCN0000027940 TGGAACTACAGCCTTGGCTTT pLKO.1 1125 CDS 100% 4.050 2.835 N Ltb4r2 n/a
5 TRCN0000027908 CCAGTGCTCTATGTCTTCACT pLKO.1 1165 CDS 100% 3.000 2.100 N Ltb4r2 n/a
6 TRCN0000027863 TGAGACACTACTGAGCTGGAA pLKO.1 342 CDS 100% 2.640 1.848 N Ltb4r2 n/a
7 TRCN0000027934 CCTGGCTGTCACTCGGCCCTT pLKO.1 672 CDS 100% 0.000 0.000 N Ltb4r2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492059 ATATATCGGGACGATGGCGCCTAT pLX_317 29.4% 80.7% 85.4% V5 (many diffs) n/a
2 TRCN0000488140 TTTCTCTGCTGCAAACACCTTCAC pLX_317 21.4% 80.7% 85.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV