Transcript: Mouse XM_006519328.1

PREDICTED: Mus musculus piwi-like RNA-mediated gene silencing 2 (Piwil2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Piwil2 (57746)
Length:
6041
CDS:
1110..4238

Additional Resources:

NCBI RefSeq record:
XM_006519328.1
NBCI Gene record:
Piwil2 (57746)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360532 GACCGAATAGAGACCTATATC pLKO_005 3255 CDS 100% 13.200 18.480 N Piwil2 n/a
2 TRCN0000009648 GCCGAGATCAGTATCAAGATT pLKO.1 2214 CDS 100% 5.625 7.875 N Piwil2 n/a
3 TRCN0000009646 GCGCTACAACAATCGTACCTA pLKO.1 2576 CDS 100% 3.000 4.200 N Piwil2 n/a
4 TRCN0000360459 GACTTGACTCAGCAGATTAAC pLKO_005 2862 CDS 100% 13.200 10.560 N Piwil2 n/a
5 TRCN0000360460 ACTGAAGCAGGAGTATCTTTA pLKO_005 4440 3UTR 100% 13.200 9.240 N Piwil2 n/a
6 TRCN0000360458 CAATGGAGAGGATCAACTTAA pLKO_005 3022 CDS 100% 13.200 9.240 N Piwil2 n/a
7 TRCN0000011811 CCATCCTTGTAGAATTAGATT pLKO.1 4347 3UTR 100% 5.625 3.938 N Piwil2 n/a
8 TRCN0000009647 CCAGTAGTATAGGCAGAGGAA pLKO.1 1795 CDS 100% 2.640 1.848 N Piwil2 n/a
9 TRCN0000011812 CCTACACACTACATCTGTGTT pLKO.1 4023 CDS 100% 0.495 0.347 N Piwil2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03529 pDONR223 100% 79.7% 81.9% None (many diffs) n/a
2 ccsbBroad304_03529 pLX_304 0% 79.7% 81.9% V5 (many diffs) n/a
3 TRCN0000469723 TTCATGCCAGTACTAGGCCGATGT pLX_317 .5% 79.7% 81.9% V5 (many diffs) n/a
Download CSV