Transcript: Mouse XM_006519329.3

PREDICTED: Mus musculus piwi-like RNA-mediated gene silencing 2 (Piwil2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Piwil2 (57746)
Length:
4971
CDS:
253..3168

Additional Resources:

NCBI RefSeq record:
XM_006519329.3
NBCI Gene record:
Piwil2 (57746)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519329.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360532 GACCGAATAGAGACCTATATC pLKO_005 2185 CDS 100% 13.200 18.480 N Piwil2 n/a
2 TRCN0000009648 GCCGAGATCAGTATCAAGATT pLKO.1 1144 CDS 100% 5.625 7.875 N Piwil2 n/a
3 TRCN0000009646 GCGCTACAACAATCGTACCTA pLKO.1 1506 CDS 100% 3.000 4.200 N Piwil2 n/a
4 TRCN0000360459 GACTTGACTCAGCAGATTAAC pLKO_005 1792 CDS 100% 13.200 10.560 N Piwil2 n/a
5 TRCN0000360460 ACTGAAGCAGGAGTATCTTTA pLKO_005 3370 3UTR 100% 13.200 9.240 N Piwil2 n/a
6 TRCN0000360458 CAATGGAGAGGATCAACTTAA pLKO_005 1952 CDS 100% 13.200 9.240 N Piwil2 n/a
7 TRCN0000011811 CCATCCTTGTAGAATTAGATT pLKO.1 3277 3UTR 100% 5.625 3.938 N Piwil2 n/a
8 TRCN0000009647 CCAGTAGTATAGGCAGAGGAA pLKO.1 725 CDS 100% 2.640 1.848 N Piwil2 n/a
9 TRCN0000011812 CCTACACACTACATCTGTGTT pLKO.1 2953 CDS 100% 0.495 0.347 N Piwil2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519329.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03529 pDONR223 100% 85.5% 87.9% None (many diffs) n/a
2 ccsbBroad304_03529 pLX_304 0% 85.5% 87.9% V5 (many diffs) n/a
3 TRCN0000469723 TTCATGCCAGTACTAGGCCGATGT pLX_317 .5% 85.5% 87.9% V5 (many diffs) n/a
Download CSV