Transcript: Mouse XM_006519434.2

PREDICTED: Mus musculus methyltransferase like 6 (Mettl6), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mettl6 (67011)
Length:
2811
CDS:
279..1046

Additional Resources:

NCBI RefSeq record:
XM_006519434.2
NBCI Gene record:
Mettl6 (67011)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312975 AGATGGAACCAGATCGTATTT pLKO_005 920 CDS 100% 13.200 18.480 N Mettl6 n/a
2 TRCN0000097556 CCTTGTCTTACTAAACGTGTA pLKO.1 785 CDS 100% 4.050 5.670 N Mettl6 n/a
3 TRCN0000097557 GCCTTGTCTTACTAAACGTGT pLKO.1 784 CDS 100% 2.640 3.696 N Mettl6 n/a
4 TRCN0000311952 GCCTTGTCTTACTAAACGTGT pLKO_005 784 CDS 100% 2.640 3.696 N Mettl6 n/a
5 TRCN0000313020 TCACGCCATGCTTAGATTTAA pLKO_005 860 CDS 100% 15.000 10.500 N Mettl6 n/a
6 TRCN0000097555 GCAGTTGACTACGTGAAGCAA pLKO.1 621 CDS 100% 3.000 2.100 N Mettl6 n/a
7 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 2297 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13166 pDONR223 100% 78.7% 75.9% None (many diffs) n/a
2 ccsbBroad304_13166 pLX_304 0% 78.7% 75.9% V5 (many diffs) n/a
3 TRCN0000472430 GCATCTCCCCTCTCATTAAAATCA pLX_317 46.7% 78.7% 75.9% V5 (many diffs) n/a
Download CSV