Construct: ORF TRCN0000472430
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003083.1_s317c1
- Derived from:
- ccsbBroadEn_13166
- DNA Barcode:
- GCATCTCCCCTCTCATTAAAATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- METTL6 (131965)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472430
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 131965 | METTL6 | methyltransferase like 6 | NM_152396.3 | 89.7% | 89.7% | 766_852del |
2 | human | 131965 | METTL6 | methyltransferase like 6 | XM_005264867.4 | 89.7% | 89.7% | 766_852del |
3 | human | 131965 | METTL6 | methyltransferase like 6 | XM_006712970.4 | 89.7% | 89.7% | 766_852del |
4 | human | 131965 | METTL6 | methyltransferase like 6 | XM_017005718.2 | 89.7% | 89.7% | 766_852del |
5 | human | 131965 | METTL6 | methyltransferase like 6 | XM_011533357.3 | 78.4% | 64.5% | (many diffs) |
6 | human | 131965 | METTL6 | methyltransferase like 6 | NM_001301791.1 | 78.4% | 65.9% | (many diffs) |
7 | human | 131965 | METTL6 | methyltransferase like 6 | XM_006712972.4 | 78.3% | 72.6% | (many diffs) |
8 | human | 131965 | METTL6 | methyltransferase like 6 | NM_001330662.2 | 77.9% | 69.1% | (many diffs) |
9 | human | 131965 | METTL6 | methyltransferase like 6 | NM_001301792.1 | 75.2% | 67.5% | 530_531ins142;576_577ins47 |
10 | human | 131965 | METTL6 | methyltransferase like 6 | XM_017005722.2 | 75.2% | 67.5% | 530_531ins142;576_577ins47 |
11 | human | 131965 | METTL6 | methyltransferase like 6 | NM_001301790.1 | 73.9% | 73.9% | 223_224ins135;631_717del |
12 | human | 131965 | METTL6 | methyltransferase like 6 | XM_017005719.1 | 73.9% | 73.9% | 223_224ins135;631_717del |
13 | human | 131965 | METTL6 | methyltransferase like 6 | XM_017005724.2 | 71.7% | 70.5% | (many diffs) |
14 | human | 131965 | METTL6 | methyltransferase like 6 | XM_017005723.1 | 61.5% | 55.3% | (many diffs) |
15 | human | 131965 | METTL6 | methyltransferase like 6 | XR_002959491.1 | 40.9% | 1_246del;776_1613del;1850_1867del | |
16 | human | 131965 | METTL6 | methyltransferase like 6 | XR_001740019.2 | 18.6% | 1_246del;775_860del;1098_4111del | |
17 | human | 131965 | METTL6 | methyltransferase like 6 | XR_001740018.2 | 16.6% | (many diffs) | |
18 | human | 131965 | METTL6 | methyltransferase like 6 | XR_940377.3 | 12% | 1_246del;775_860del;1098_6351del | |
19 | mouse | 67011 | Mettl6 | methyltransferase like 6 | NM_025907.3 | 78.8% | 80.1% | (many diffs) |
20 | mouse | 67011 | Mettl6 | methyltransferase like 6 | XM_006519432.3 | 78.8% | 80.1% | (many diffs) |
21 | mouse | 67011 | Mettl6 | methyltransferase like 6 | XM_006519434.2 | 78.7% | 75.9% | (many diffs) |
22 | mouse | 67011 | Mettl6 | methyltransferase like 6 | XM_011245154.1 | 78.6% | 78% | (many diffs) |
23 | mouse | 67011 | Mettl6 | methyltransferase like 6 | XM_011245155.1 | 76.3% | 77.6% | (many diffs) |
24 | mouse | 67011 | Mettl6 | methyltransferase like 6 | XM_017316161.1 | 67.1% | 68.2% | (many diffs) |
25 | mouse | 67011 | Mettl6 | methyltransferase like 6 | XM_006519436.3 | 65.2% | 66.6% | (many diffs) |
26 | mouse | 67011 | Mettl6 | methyltransferase like 6 | XM_006519437.3 | 64.8% | 58.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 831
- ORF length:
- 765
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ttctttgcaa aggaaagggc tgcaggcaag gattctcacc tctgaagaag 121 aggagaaact gaaaagagac caaactttgg tgtctgattt taaacagcag aaattggaac 181 aagaggctca gaaaaattgg gatctttttt acaaaagaaa tagcactaat ttcttcaaag 241 acagacactg gaccaccaga gagtttgagg agctaagatc atgtagagag tttgaagatc 301 aaaagttaac aatgcttgaa gctggctgtg gggttggaaa ctgtttattc ccacttttag 361 aagaagatcc gaatatcttt gcctatgcct gtgatttttc tccaagagcc attgaatatg 421 ttaagcaaaa tcctttatat gatacagaaa gatgcaaggt attccagtgt gatcTGACTA 481 AAGATGATCT TCTGGATCAT GTACCGCCAG AGTCTGTGGA TGTTGTTATG TTGATATTTG 541 TGCTGTCAGC TGTTCATCCT GATAAGATGC ACCTTGTCTT ACAAAACATT TACAAGGTAT 601 TAAAACCAGG CAAAAGTGTC TTGTTTCGTG ACTACGGACT GTATGATCAT GCCATGCTTA 661 GGTTTAAAGC CAGCAGCAAA CTTGGAGAAA ACTTTTATGT TAGACAAGAT GGGACCAGAT 721 CATATTTTTT TACTGATGAC TTCCTGGCTC AGCTCTTTAT GGACACAGGT TATGAAGAAG 781 TGGTAAACGA GTATGTGTTT CGAGAGACGG TGAATAAAAA AGAAGGCCTG TGCCCAACTT 841 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 901 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 961 CTTGTGGAAA GGACGAGCAT CTCCCCTCTC ATTAAAATCA ACGCGTTAAG TCgacaatca 1021 acctctggat tacaaaattt gtgaaagatt