Transcript: Mouse XM_006519994.3

PREDICTED: Mus musculus Nipped-B homolog (Drosophila) (Nipbl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nipbl (71175)
Length:
9544
CDS:
229..8625

Additional Resources:

NCBI RefSeq record:
XM_006519994.3
NBCI Gene record:
Nipbl (71175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124034 CGCGCCTTTCTTATTTCTTTA pLKO.1 7429 CDS 100% 13.200 18.480 N Nipbl n/a
2 TRCN0000313515 GGACGTAAACCGCCCACTTAA pLKO_005 1452 CDS 100% 13.200 18.480 N Nipbl n/a
3 TRCN0000124035 GCGTGCTTGATTGTTCGATAT pLKO.1 5467 CDS 100% 10.800 15.120 N Nipbl n/a
4 TRCN0000317135 GCGTGCTTGATTGTTCGATAT pLKO_005 5467 CDS 100% 10.800 15.120 N Nipbl n/a
5 TRCN0000124036 CGCTTCTCAAAGGAAGTTCAA pLKO.1 1696 CDS 100% 4.950 6.930 N Nipbl n/a
6 TRCN0000313516 GATTGTGGAGAGACCTAATTA pLKO_005 4091 CDS 100% 15.000 10.500 N Nipbl n/a
7 TRCN0000148381 CTCAGGATTCAGACTCCATAA pLKO.1 1901 CDS 100% 10.800 7.560 N NIPBL n/a
8 TRCN0000124037 GCCTGTTTCAATAGATACTAT pLKO.1 6532 CDS 100% 5.625 3.938 N Nipbl n/a
9 TRCN0000317072 GCCTGTTTCAATAGATACTAT pLKO_005 6532 CDS 100% 5.625 3.938 N Nipbl n/a
10 TRCN0000124038 CCTCCTCTTTAATTCACGAAT pLKO.1 345 CDS 100% 4.950 3.465 N Nipbl n/a
11 TRCN0000317071 CCTCCTCTTTAATTCACGAAT pLKO_005 345 CDS 100% 4.950 3.465 N Nipbl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15773 pDONR223 0% 5.5% 5.7% None (many diffs) n/a
2 ccsbBroad304_15773 pLX_304 0% 5.5% 5.7% V5 (many diffs) n/a
3 TRCN0000478612 TTCTAGCTCAGTTGTAAAGACCCC pLX_317 66% 5.5% 5.7% V5 (many diffs) n/a
Download CSV