Transcript: Mouse XM_006520092.4

PREDICTED: Mus musculus LMBR1 domain containing 2 (Lmbrd2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Lmbrd2 (320506)
Length:
3603
CDS:
299..1999

Additional Resources:

NCBI RefSeq record:
XM_006520092.4
NBCI Gene record:
Lmbrd2 (320506)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520092.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198724 CGGCACTTACTTGCTGATATT pLKO.1 379 CDS 100% 13.200 10.560 N Lmbrd2 n/a
2 TRCN0000197738 GTGTGTAGACACAATACTTAA pLKO.1 712 CDS 100% 13.200 9.240 N Lmbrd2 n/a
3 TRCN0000178489 GCTAACTTGGTTTCATGCTAA pLKO.1 2273 3UTR 100% 4.950 3.465 N Lmbrd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520092.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09332 pDONR223 100% 72.9% 77.4% None (many diffs) n/a
2 ccsbBroad304_09332 pLX_304 0% 72.9% 77.4% V5 (many diffs) n/a
3 TRCN0000470126 TGCTAGGGAATCCTAGGAAAAACG pLX_317 18.5% 72.9% 77.4% V5 (many diffs) n/a
Download CSV