Transcript: Mouse XM_006520265.1

PREDICTED: Mus musculus prickle planar cell polarity protein 1 (Prickle1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prickle1 (106042)
Length:
4460
CDS:
626..3124

Additional Resources:

NCBI RefSeq record:
XM_006520265.1
NBCI Gene record:
Prickle1 (106042)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219482 GACAACATGGTTACGAATAAG pLKO.1 1964 CDS 100% 13.200 18.480 N Prickle1 n/a
2 TRCN0000241978 TTACACTGCCATGCTAGATTT pLKO_005 3751 3UTR 100% 13.200 18.480 N Prickle1 n/a
3 TRCN0000219484 TGCCCATGCCACGTCTGATTA pLKO.1 2830 CDS 100% 13.200 10.560 N Prickle1 n/a
4 TRCN0000241982 CAGAGTATCCGGGATTCTATG pLKO_005 2219 CDS 100% 10.800 8.640 N Prickle1 n/a
5 TRCN0000017406 CCTACTATACAGATGACCTTT pLKO.1 3003 CDS 100% 4.950 3.960 N PRICKLE1 n/a
6 TRCN0000342937 CCTACTATACAGATGACCTTT pLKO_005 3003 CDS 100% 4.950 3.960 N PRICKLE1 n/a
7 TRCN0000219485 CCAGTCTTGGTGCCATATTAA pLKO.1 3281 3UTR 100% 15.000 10.500 N Prickle1 n/a
8 TRCN0000219483 AGCAAGCCAAGACCGTCATTA pLKO.1 2288 CDS 100% 13.200 9.240 N Prickle1 n/a
9 TRCN0000241981 CCGACCACAGCAGGTCAAATT pLKO_005 2506 CDS 100% 13.200 9.240 N Prickle1 n/a
10 TRCN0000219481 TTTGTCTGCTTCACGTGTAAT pLKO.1 1091 CDS 100% 13.200 9.240 N Prickle1 n/a
11 TRCN0000241979 CAGTTGCCTCCACACGATAAC pLKO_005 848 CDS 100% 10.800 7.560 N Prickle1 n/a
12 TRCN0000241980 CGGAAGCTACGACATCGAAAT pLKO_005 2548 CDS 100% 10.800 7.560 N Prickle1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04968 pDONR223 100% 84.8% 93.1% None (many diffs) n/a
2 ccsbBroad304_04968 pLX_304 0% 84.8% 93.1% V5 (many diffs) n/a
3 TRCN0000473091 TTACTACCAGTTTAATTAACAGAT pLX_317 17.6% 84.8% 93.1% V5 (many diffs) n/a
Download CSV