Transcript: Mouse XM_006520420.1

PREDICTED: Mus musculus PTK2 protein tyrosine kinase 2 (Ptk2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptk2 (14083)
Length:
4652
CDS:
368..3706

Additional Resources:

NCBI RefSeq record:
XM_006520420.1
NBCI Gene record:
Ptk2 (14083)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146703 ATGTGGGAGATACTGATGCA pXPR_003 TGG 2021 61% 24 1.1467 Ptk2 PTK2 75544
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023488 CCTGGCATCTTTGATATTATA pLKO.1 2095 CDS 100% 15.000 21.000 N Ptk2 n/a
2 TRCN0000321963 CCTGGCATCTTTGATATTATA pLKO_005 2095 CDS 100% 15.000 21.000 N Ptk2 n/a
3 TRCN0000023484 CGGTCCAATGACAAGGTATAT pLKO.1 3302 CDS 100% 13.200 18.480 N Ptk2 n/a
4 TRCN0000321964 CGGTCCAATGACAAGGTATAT pLKO_005 3302 CDS 100% 13.200 18.480 N Ptk2 n/a
5 TRCN0000196310 GATGTTGGTTTAAAGCGATTT pLKO.1 1097 CDS 100% 10.800 15.120 N PTK2 n/a
6 TRCN0000344535 GATGTTGGTTTAAAGCGATTT pLKO_005 1097 CDS 100% 10.800 15.120 N PTK2 n/a
7 TRCN0000023485 GCCTTAACAATGCGTCAGTTT pLKO.1 1952 CDS 100% 4.950 6.930 N Ptk2 n/a
8 TRCN0000121130 GCCTTAACAATGCGTCAGTTT pLKO.1 1952 CDS 100% 4.950 6.930 N PTK2 n/a
9 TRCN0000350696 GCCTTAACAATGCGTCAGTTT pLKO_005 1952 CDS 100% 4.950 6.930 N Ptk2 n/a
10 TRCN0000023487 CGAGTATTAAAGGTCTTTCAT pLKO.1 602 CDS 100% 5.625 4.500 N Ptk2 n/a
11 TRCN0000194838 CCTAAGAGTTTACTGGATTCT pLKO.1 1121 CDS 100% 4.950 3.960 N PTK2 n/a
12 TRCN0000321899 TATCCAGACTGTGTTGCAATA pLKO_005 4115 3UTR 100% 10.800 7.560 N Ptk2 n/a
13 TRCN0000023486 CCAACCTTAATAGAGAAGAAA pLKO.1 1194 CDS 100% 5.625 3.938 N Ptk2 n/a
14 TRCN0000026975 GTTGCCATCAATACCAAAGTT pLKO.1 1606 CDS 100% 5.625 3.938 N Gm1872 n/a
15 TRCN0000026970 GACAGATGACTATGCAGAGAT pLKO.1 1696 CDS 100% 4.950 3.465 N Gm1872 n/a
16 TRCN0000026961 GCAGAGATCATCGATGAGGAA pLKO.1 1709 CDS 100% 2.640 1.848 N Gm1872 n/a
17 TRCN0000027011 TGAGGAAGACACATACACCAT pLKO.1 1723 CDS 100% 2.640 1.584 N Gm1872 n/a
18 TRCN0000121128 CCAGGGATTATGAGATTCAAA pLKO.1 1773 CDS 100% 5.625 3.938 N PTK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14818 pDONR223 0% 85.8% 91.9% None (many diffs) n/a
2 ccsbBroad304_14818 pLX_304 0% 85.8% 91.9% V5 (many diffs) n/a
3 TRCN0000471115 ACCCGTCAGACGGGGAGAATATCA pLX_317 13% 85.8% 91.9% V5 (many diffs) n/a
4 TRCN0000489116 AGGTTGAACTATACACTATACCTG pLX_317 12.9% 85.8% 91.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_13934 pDONR223 100% 54% 57.3% None (many diffs) n/a
6 ccsbBroad304_13934 pLX_304 0% 54% 57.3% V5 (many diffs) n/a
7 TRCN0000465393 CCGAGCTAACCTATAGCACCACCA pLX_317 11.8% 54% 57.3% V5 (many diffs) n/a
Download CSV