Transcript: Mouse XM_006520455.1

PREDICTED: Mus musculus nuclear receptor subfamily 4, group A, member 1 (Nr4a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nr4a1 (15370)
Length:
2522
CDS:
66..1979

Additional Resources:

NCBI RefSeq record:
XM_006520455.1
NBCI Gene record:
Nr4a1 (15370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234020 CGCCTGGCATACCGATCTAAA pLKO_005 1530 CDS 100% 13.200 18.480 N Nr4a1 n/a
2 TRCN0000234018 TGCCGGTGACGTGCAACAATT pLKO_005 1379 CDS 100% 13.200 18.480 N Nr4a1 n/a
3 TRCN0000025978 GCCCATTAGATGAGACCCTAT pLKO.1 532 CDS 100% 4.050 5.670 N Nr4a1 n/a
4 TRCN0000218931 CTATTGTGGACAAGATCTTTA pLKO_005 1939 CDS 100% 13.200 10.560 N Nr4a1 n/a
5 TRCN0000234019 TCTGGTTCCCTGGACGTTATC pLKO_005 1413 CDS 100% 10.800 8.640 N Nr4a1 n/a
6 TRCN0000234021 CATGTGCCTTTAAGCCTATAG pLKO_005 2028 3UTR 100% 10.800 7.560 N Nr4a1 n/a
7 TRCN0000026008 CCATGTGCCTTTAAGCCTATA pLKO.1 2027 3UTR 100% 10.800 7.560 N Nr4a1 n/a
8 TRCN0000025976 CCAGAGTTCTCTGAAATTGTT pLKO.1 791 CDS 100% 5.625 3.938 N Nr4a1 n/a
9 TRCN0000026038 CTTTGGTGATTGGATTGACAA pLKO.1 1616 CDS 100% 4.950 3.465 N Nr4a1 n/a
10 TRCN0000025999 CAAGTACATCTGCCTGGCAAA pLKO.1 1079 CDS 100% 4.050 2.835 N Nr4a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00760 pDONR223 100% 81% 86.1% None (many diffs) n/a
2 ccsbBroad304_00760 pLX_304 0% 81% 86.1% V5 (many diffs) n/a
3 TRCN0000467273 TGACCCAGGTAACATAAACGCCTC pLX_317 22.6% 81% 86.1% V5 (many diffs) n/a
Download CSV