Transcript: Mouse XM_006520880.2

PREDICTED: Mus musculus SUMO1/sentrin specific peptidase 1 (Senp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Senp1 (223870)
Length:
6819
CDS:
577..2673

Additional Resources:

NCBI RefSeq record:
XM_006520880.2
NBCI Gene record:
Senp1 (223870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031013 CGTAACGGTAACCAGGATGAA pLKO.1 2044 CDS 100% 4.950 6.930 N Senp1 n/a
2 TRCN0000301209 CGTAACGGTAACCAGGATGAA pLKO_005 2044 CDS 100% 4.950 6.930 N Senp1 n/a
3 TRCN0000031009 CGGGCCTTTGTAGATTTCCTA pLKO.1 3694 3UTR 100% 3.000 4.200 N Senp1 n/a
4 TRCN0000301210 CGGGCCTTTGTAGATTTCCTA pLKO_005 3694 3UTR 100% 3.000 4.200 N Senp1 n/a
5 TRCN0000031012 CCAGCCTATCGTCCAGATTAT pLKO.1 865 CDS 100% 13.200 9.240 N Senp1 n/a
6 TRCN0000031010 CGCAAAGACATTCAGACTCTA pLKO.1 2098 CDS 100% 4.950 3.465 N Senp1 n/a
7 TRCN0000331486 CGCAAAGACATTCAGACTCTA pLKO_005 2098 CDS 100% 4.950 3.465 N Senp1 n/a
8 TRCN0000031011 GCCATATTTCCGAAAGCGAAT pLKO.1 2619 CDS 100% 4.050 2.835 N Senp1 n/a
9 TRCN0000301208 GCCATATTTCCGAAAGCGAAT pLKO_005 2619 CDS 100% 4.050 2.835 N Senp1 n/a
10 TRCN0000004397 TGACCATTACACGCAAAGATA pLKO.1 2087 CDS 100% 5.625 4.500 N SENP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11906 pDONR223 100% 79% 80.7% None (many diffs) n/a
2 ccsbBroad304_11906 pLX_304 0% 79% 80.7% V5 (many diffs) n/a
3 TRCN0000479266 TGCATCGCTTTAGCTGCGGAATCT pLX_317 12.4% 79% 80.7% V5 (many diffs) n/a
Download CSV