Transcript: Mouse XM_006521087.2

PREDICTED: Mus musculus X-prolyl aminopeptidase 3, mitochondrial (Xpnpep3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xpnpep3 (321003)
Length:
5873
CDS:
145..1428

Additional Resources:

NCBI RefSeq record:
XM_006521087.2
NBCI Gene record:
Xpnpep3 (321003)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031961 GCCTTTCTTTACGCGAAGTTT pLKO.1 745 CDS 100% 5.625 7.875 N Xpnpep3 n/a
2 TRCN0000031962 GAGACGAACATGGTTTGGTAT pLKO.1 499 CDS 100% 4.950 3.960 N Xpnpep3 n/a
3 TRCN0000031959 GCTCCGATAGATGAAGCCTTT pLKO.1 730 CDS 100% 4.050 3.240 N Xpnpep3 n/a
4 TRCN0000073928 GCATTCCAGTTAACACATTTA pLKO.1 1668 3UTR 100% 13.200 9.240 N XPNPEP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03908 pDONR223 100% 73.6% 77.7% None (many diffs) n/a
2 ccsbBroad304_03908 pLX_304 0% 73.6% 77.7% V5 (many diffs) n/a
3 TRCN0000478758 TAGCGCCAACACCGTCGGCAAATT pLX_317 23.4% 73.6% 77.7% V5 (many diffs) n/a
Download CSV