Transcript: Mouse XM_006521193.2

PREDICTED: Mus musculus estrogen receptor-binding fragment-associated gene 9 (Ebag9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ebag9 (55960)
Length:
2292
CDS:
535..1176

Additional Resources:

NCBI RefSeq record:
XM_006521193.2
NBCI Gene record:
Ebag9 (55960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120648 CCCACAAGTGTAAAGATCGAA pLKO.1 736 CDS 100% 3.000 4.200 N Ebag9 n/a
2 TRCN0000350243 CCCACAAGTGTAAAGATCGAA pLKO_005 736 CDS 100% 3.000 4.200 N Ebag9 n/a
3 TRCN0000120649 GCAACAGTGTTCTCGTTCCTA pLKO.1 580 CDS 100% 3.000 4.200 N Ebag9 n/a
4 TRCN0000314440 GCAACAGTGTTCTCGTTCCTA pLKO_005 580 CDS 100% 3.000 4.200 N Ebag9 n/a
5 TRCN0000120651 CAAGGACATGACACCAACTAT pLKO.1 819 CDS 100% 5.625 3.938 N Ebag9 n/a
6 TRCN0000314379 CAAGGACATGACACCAACTAT pLKO_005 819 CDS 100% 5.625 3.938 N Ebag9 n/a
7 TRCN0000120650 GTTCTCGTTCCTAAAGAGATT pLKO.1 588 CDS 100% 4.950 3.465 N Ebag9 n/a
8 TRCN0000314378 GTTCTCGTTCCTAAAGAGATT pLKO_005 588 CDS 100% 4.950 3.465 N Ebag9 n/a
9 TRCN0000303851 AGGACATGACACCAACTATTA pLKO_005 821 CDS 100% 13.200 10.560 N EBAG9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02095 pDONR223 100% 91% 97.6% None (many diffs) n/a
2 ccsbBroad304_02095 pLX_304 0% 91% 97.6% V5 (many diffs) n/a
3 TRCN0000473623 CCGACGAGGGCTCGACGATAGCGA pLX_317 59.1% 90.9% 94.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489314 CTCAAACTTACCCCAGACTTGTGT pLX_317 58.8% 91% 97.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_07369 pDONR223 100% 90.9% 97.1% None (many diffs) n/a
6 ccsbBroad304_07369 pLX_304 0% 90.9% 97.1% V5 (many diffs) n/a
7 TRCN0000473938 AGAGGTTTGCTATCCCGTCCTCCG pLX_317 81.9% 90.9% 97.1% V5 (many diffs) n/a
Download CSV