Transcript: Mouse XM_006521211.2

PREDICTED: Mus musculus coatomer protein complex, subunit zeta 1 (Copz1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Copz1 (56447)
Length:
1982
CDS:
91..639

Additional Resources:

NCBI RefSeq record:
XM_006521211.2
NBCI Gene record:
Copz1 (56447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380531 GACTCTTCGCCAAGTACTATG pLKO_005 164 CDS 100% 10.800 15.120 N Copz1 n/a
2 TRCN0000100683 CGGATAGTGAAATCGCTCTGT pLKO.1 254 CDS 100% 2.640 3.696 N Copz1 n/a
3 TRCN0000334968 CGGATAGTGAAATCGCTCTGT pLKO_005 254 CDS 100% 2.640 3.696 N Copz1 n/a
4 TRCN0000100682 CGATCTCTATTTCTATGTGAT pLKO.1 309 CDS 100% 4.950 3.960 N Copz1 n/a
5 TRCN0000100684 GTTCTGAACTGCCTCTTCGAT pLKO.1 367 CDS 100% 3.000 2.400 N Copz1 n/a
6 TRCN0000334969 GTTCTGAACTGCCTCTTCGAT pLKO_005 367 CDS 100% 3.000 2.400 N Copz1 n/a
7 TRCN0000379891 AGGATTGACAGTGGTCTATAA pLKO_005 279 CDS 100% 13.200 9.240 N Copz1 n/a
8 TRCN0000100680 CCTTGGTTTCTTGGCCCTTTA pLKO.1 1094 3UTR 100% 10.800 7.560 N Copz1 n/a
9 TRCN0000335042 CCTTGGTTTCTTGGCCCTTTA pLKO_005 1094 3UTR 100% 10.800 7.560 N Copz1 n/a
10 TRCN0000100681 GCCATCCTGATTCTGGACAAT pLKO.1 133 CDS 100% 4.950 3.465 N Copz1 n/a
11 TRCN0000363778 GCCATCCTGATTCTGGACAAT pLKO_005 133 CDS 100% 4.950 3.465 N Copz1 n/a
12 TRCN0000065001 GTCAGCCAAAGAACAGATCAA pLKO.1 814 3UTR 100% 4.950 3.465 N COPZ1 n/a
13 TRCN0000298993 GTCAGCCAAAGAACAGATCAA pLKO_005 814 3UTR 100% 4.950 3.465 N COPZ1 n/a
14 TRCN0000374707 AGCCAAAGAACAGATCAAGTG pLKO_005 817 3UTR 100% 4.050 2.835 N Copz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02686 pDONR223 100% 83.9% 87.3% None (many diffs) n/a
2 ccsbBroad304_02686 pLX_304 0% 83.9% 87.3% V5 (many diffs) n/a
3 TRCN0000466412 AAACCCCAGAACTGAAAACCACAG pLX_317 74.5% 83.9% 87.3% V5 (many diffs) n/a
Download CSV