Transcript: Mouse XM_006521475.3

PREDICTED: Mus musculus family with sequence similarity 118, member A (Fam118a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam118a (73225)
Length:
1814
CDS:
632..1759

Additional Resources:

NCBI RefSeq record:
XM_006521475.3
NBCI Gene record:
Fam118a (73225)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521475.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279046 CTGGATCCATCGGGCTATAAA pLKO_005 1256 CDS 100% 15.000 21.000 N Fam118a n/a
2 TRCN0000279060 ACACTTCGGGACCAGATATTC pLKO_005 1361 CDS 100% 13.200 18.480 N Fam118a n/a
3 TRCN0000379319 GCACCACCTTACTGGGTAATG pLKO_005 1608 CDS 100% 10.800 15.120 N Fam118a n/a
4 TRCN0000173280 GCCAAATAAGGTGGACTTGGA pLKO.1 1405 CDS 100% 2.640 3.696 N Fam118a n/a
5 TRCN0000194380 CCATGATCTGATCCGGAAGAT pLKO.1 925 CDS 100% 4.950 3.960 N Fam118a n/a
6 TRCN0000278995 AGTGGGCAAGAGGCCATATTA pLKO_005 1182 CDS 100% 15.000 10.500 N Fam118a n/a
7 TRCN0000375612 AGGACCTGCTCTTGGTCATTG pLKO_005 735 CDS 100% 10.800 7.560 N Fam118a n/a
8 TRCN0000173733 CGTGCCAAATAAGGTGGACTT pLKO.1 1402 CDS 100% 4.050 2.835 N Fam118a n/a
9 TRCN0000174961 GAAGACCATTTCTTTAAGCAT pLKO.1 1454 CDS 100% 3.000 2.100 N Fam118a n/a
10 TRCN0000193441 GAGTTCTTCATATTCATGGTT pLKO.1 1209 CDS 100% 3.000 2.100 N Fam118a n/a
11 TRCN0000297596 GAGTTCTTCATATTCATGGTT pLKO_005 1209 CDS 100% 3.000 2.100 N Fam118a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521475.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08451 pDONR223 100% 81.9% 86.4% None (many diffs) n/a
2 ccsbBroad304_08451 pLX_304 0% 81.9% 86.4% V5 (many diffs) n/a
3 TRCN0000480532 TAGCATGTCAGCTTCCGAGAGTTT pLX_317 39.1% 81.9% 86.4% V5 (many diffs) n/a
Download CSV