Transcript: Mouse XM_006521697.3

PREDICTED: Mus musculus endothelin converting enzyme 2 (Ece2), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ece2 (107522)
Length:
2577
CDS:
243..2372

Additional Resources:

NCBI RefSeq record:
XM_006521697.3
NBCI Gene record:
Ece2 (107522)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031178 CCATGAGTTGACACATGCCTT pLKO.1 2039 CDS 100% 2.640 3.696 N Ece2 n/a
2 TRCN0000031177 GATGCCATCTATGATATGATT pLKO.1 1713 CDS 100% 5.625 3.938 N Ece2 n/a
3 TRCN0000031175 GCTGCTTACAATGCTTACAAA pLKO.1 2250 CDS 100% 5.625 3.938 N Ece2 n/a
4 TRCN0000031176 GCCATACTGAAGCACCTACTT pLKO.1 693 CDS 100% 4.950 3.465 N Ece2 n/a
5 TRCN0000046971 CCATCTATGATATGATTGGTT pLKO.1 1717 CDS 100% 3.000 2.100 N ECE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07474 pDONR223 100% 78.5% 81.8% None (many diffs) n/a
2 ccsbBroad304_07474 pLX_304 0% 78.5% 81.8% V5 (many diffs) n/a
3 TRCN0000475472 CCGCGACCCTACGAAGCCATTGCC pLX_317 13.3% 78.5% 81.8% V5 (many diffs) n/a
Download CSV