Transcript: Mouse XM_006521703.3

PREDICTED: Mus musculus myosin, light polypeptide kinase (Mylk), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mylk (107589)
Length:
7856
CDS:
143..5968

Additional Resources:

NCBI RefSeq record:
XM_006521703.3
NBCI Gene record:
Mylk (107589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418381 TGCGTGCAGTCAACGTCTATG pLKO_005 4419 CDS 100% 10.800 15.120 N Mylk n/a
2 TRCN0000220707 GCGGGAGTGTATCAAGTACAT pLKO.1 4885 CDS 100% 4.950 6.930 N Mylk n/a
3 TRCN0000427591 GATGATCTAGTTAGGCTATTT pLKO_005 6088 3UTR 100% 13.200 10.560 N Mylk n/a
4 TRCN0000195516 CTCCTGAAGTGATCAACTATG pLKO.1 5094 CDS 100% 10.800 8.640 N MYLK n/a
5 TRCN0000412829 ATCACCAGCAACTCGTCTAAT pLKO_005 6222 3UTR 100% 13.200 9.240 N Mylk n/a
6 TRCN0000220708 GCCTCGTCACACATGTCTAAA pLKO.1 164 CDS 100% 13.200 9.240 N Mylk n/a
7 TRCN0000422749 GCTGATGCCTGGGAGATATAC pLKO_005 6134 3UTR 100% 13.200 9.240 N Mylk n/a
8 TRCN0000425279 TATTCTGGTCAGCGGACTTTC pLKO_005 5164 CDS 100% 10.800 7.560 N Mylk n/a
9 TRCN0000000936 ACTGTCCTCTATGGCAATGAT pLKO.1 5479 CDS 100% 5.625 3.938 N MYLK n/a
10 TRCN0000220705 GCTAGATTTGACTGCAAGATT pLKO.1 5684 CDS 100% 5.625 3.938 N Mylk n/a
11 TRCN0000220709 GCGGAGAAACTAGAGTCTGAA pLKO.1 5555 CDS 100% 4.950 3.465 N Mylk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491341 TTCTTAAGACCGAAAAATAGATTC pLX_317 10.1% 50.1% 52% V5 (many diffs) n/a
2 TRCN0000489873 TTTACCTCCTTTTCCTACACCTGC pLX_317 12.6% 50% 51.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV