Transcript: Mouse XM_006521705.2

PREDICTED: Mus musculus myosin, light polypeptide kinase (Mylk), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mylk (107589)
Length:
2347
CDS:
126..2285

Additional Resources:

NCBI RefSeq record:
XM_006521705.2
NBCI Gene record:
Mylk (107589)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418381 TGCGTGCAGTCAACGTCTATG pLKO_005 736 CDS 100% 10.800 15.120 N Mylk n/a
2 TRCN0000220707 GCGGGAGTGTATCAAGTACAT pLKO.1 1202 CDS 100% 4.950 6.930 N Mylk n/a
3 TRCN0000195516 CTCCTGAAGTGATCAACTATG pLKO.1 1411 CDS 100% 10.800 8.640 N MYLK n/a
4 TRCN0000425279 TATTCTGGTCAGCGGACTTTC pLKO_005 1481 CDS 100% 10.800 7.560 N Mylk n/a
5 TRCN0000000936 ACTGTCCTCTATGGCAATGAT pLKO.1 1796 CDS 100% 5.625 3.938 N MYLK n/a
6 TRCN0000220705 GCTAGATTTGACTGCAAGATT pLKO.1 2001 CDS 100% 5.625 3.938 N Mylk n/a
7 TRCN0000220709 GCGGAGAAACTAGAGTCTGAA pLKO.1 1872 CDS 100% 4.950 3.465 N Mylk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489873 TTTACCTCCTTTTCCTACACCTGC pLX_317 12.6% 57.9% 62.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491341 TTCTTAAGACCGAAAAATAGATTC pLX_317 10.1% 57.9% 62.1% V5 (many diffs) n/a
Download CSV