Transcript: Mouse XM_006521749.3

PREDICTED: Mus musculus chloride channel, voltage-sensitive 2 (Clcn2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clcn2 (12724)
Length:
2850
CDS:
114..2042

Additional Resources:

NCBI RefSeq record:
XM_006521749.3
NBCI Gene record:
Clcn2 (12724)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521749.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422398 CCTAGCTCCGAGACATCTATC pLKO_005 1338 CDS 100% 10.800 15.120 N Clcn2 n/a
2 TRCN0000069379 GCCATCGCTCTATGACAGTAT pLKO.1 986 CDS 100% 4.950 6.930 N Clcn2 n/a
3 TRCN0000069378 GCAGAACTAAACTGGGTTTAT pLKO.1 2190 3UTR 100% 13.200 9.240 N Clcn2 n/a
4 TRCN0000438500 GTCACAGCACAGGGTGTTAAA pLKO_005 1872 CDS 100% 13.200 9.240 N Clcn2 n/a
5 TRCN0000069380 GAGACCCTAGTCACTCTGTTT pLKO.1 522 CDS 100% 4.950 3.465 N Clcn2 n/a
6 TRCN0000069382 CCATGCTTATGTCACCAGCAT pLKO.1 1793 CDS 100% 0.264 0.185 N Clcn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521749.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10736 pDONR223 100% 51.5% 54.6% None (many diffs) n/a
2 ccsbBroad304_10736 pLX_304 0% 51.5% 54.6% V5 (many diffs) n/a
3 TRCN0000470498 GCCGCGCAAACCTAATCCCCCCTC pLX_317 35.6% 51.5% 54.6% V5 (many diffs) n/a
4 TRCN0000489431 ATATAACCCGGTACCCCGACTGAA pLX_317 35.6% 51.5% 54.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV