Transcript: Mouse XM_006522055.3

PREDICTED: Mus musculus ATPase type 13A4 (Atp13a4), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp13a4 (224079)
Length:
2444
CDS:
106..2097

Additional Resources:

NCBI RefSeq record:
XM_006522055.3
NBCI Gene record:
Atp13a4 (224079)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101396 CGACTCTTATTGGTGTAACAA pLKO.1 1340 CDS 100% 5.625 7.875 N Atp13a4 n/a
2 TRCN0000101395 CGATACCTAAACAGTTATCAA pLKO.1 2105 3UTR 100% 5.625 7.875 N Atp13a4 n/a
3 TRCN0000101398 CGGCATCTATCTCTTGGAAAT pLKO.1 776 CDS 100% 10.800 7.560 N Atp13a4 n/a
4 TRCN0000101399 GCCAATATTTCAGCAGCTTAT pLKO.1 929 CDS 100% 10.800 7.560 N Atp13a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14308 pDONR223 100% 22.5% 3.2% None (many diffs) n/a
2 ccsbBroad304_14308 pLX_304 0% 22.5% 3.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477341 GCCTGCTTTTAAACAATCATGTAG pLX_317 13.4% 22.5% 3.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV