Transcript: Mouse XM_006522123.1

PREDICTED: Mus musculus leishmanolysin-like (metallopeptidase M8 family) (Lmln), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lmln (239833)
Length:
5512
CDS:
123..1439

Additional Resources:

NCBI RefSeq record:
XM_006522123.1
NBCI Gene record:
Lmln (239833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031215 CCGACTGTAGAATCCTGGAAA pLKO.1 967 CDS 100% 4.950 6.930 N Lmln n/a
2 TRCN0000031216 CCGCCCTTCAACTATAGTCTT pLKO.1 273 CDS 100% 4.950 3.960 N Lmln n/a
3 TRCN0000424225 TGCTAACCTGTGTCCAAATAT pLKO_005 104 5UTR 100% 15.000 10.500 N LMLN n/a
4 TRCN0000031214 GCTGGCATTTAAGTGGCGAAT pLKO.1 934 CDS 100% 4.050 2.835 N Lmln n/a
5 TRCN0000031218 GCTTGTATCAGTGGAGTGATA pLKO.1 295 CDS 100% 0.495 0.347 N Lmln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488044 ACCAAGTACCCACTTCCCCATGTA pLX_317 17% 49.1% 54.5% V5 (many diffs) n/a
Download CSV