Transcript: Mouse XM_006522147.3

PREDICTED: Mus musculus mitogen-activated protein kinase 1 (Mapk1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mapk1 (26413)
Length:
2930
CDS:
249..1325

Additional Resources:

NCBI RefSeq record:
XM_006522147.3
NBCI Gene record:
Mapk1 (26413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522147.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023160 CCAACCATTGAGCAAATGAAA pLKO.1 519 CDS 100% 5.625 7.875 N Mapk1 n/a
2 TRCN0000360489 AGCCAGGATACAGATCTTAAA pLKO_005 1306 CDS 100% 13.200 9.240 N Mapk1 n/a
3 TRCN0000360487 CCCATACCTGGAGCAGTATTA pLKO_005 1172 CDS 100% 13.200 9.240 N Mapk1 n/a
4 TRCN0000023162 GCTCTGGATTTACTGGATAAA pLKO.1 1098 CDS 100% 13.200 9.240 N Mapk1 n/a
5 TRCN0000360558 GGGTATCCCTGGATGGTATTA pLKO_005 1815 3UTR 100% 13.200 9.240 N Mapk1 n/a
6 TRCN0000199434 CCAGCCAGGATACAGATCTTA pLKO.1 1304 CDS 100% 5.625 3.938 N MAPK1 n/a
7 TRCN0000023163 GCTCCAGAAATTATGTTGAAT pLKO.1 825 CDS 100% 5.625 3.938 N Mapk1 n/a
8 TRCN0000054729 GACATGGAGTTGGACGACTTA pLKO.1 1236 CDS 100% 4.950 3.465 N Mapk1 n/a
9 TRCN0000023159 GCTAGGACATAAGGCACCTTA pLKO.1 1722 3UTR 100% 4.950 3.465 N Mapk1 n/a
10 TRCN0000054728 GCTGTGGAGTTGATGGTGTTA pLKO.1 2522 3UTR 100% 4.950 3.465 N Mapk1 n/a
11 TRCN0000023161 CCTACTGTCAAAGAACCCTAA pLKO.1 430 CDS 100% 4.050 2.835 N Mapk1 n/a
12 TRCN0000054730 GCTGAATCACATCCTGGGTAT pLKO.1 950 CDS 100% 4.050 2.835 N Mapk1 n/a
13 TRCN0000010050 TATCCATTCAGCTAACGTTCT pLKO.1 659 CDS 100% 4.050 2.835 N MAPK1 n/a
14 TRCN0000342295 TATCCATTCAGCTAACGTTCT pLKO_005 659 CDS 100% 4.050 2.835 N MAPK1 n/a
15 TRCN0000054731 TCAACAAAGTTCGAGTTGCTA pLKO.1 379 CDS 100% 3.000 2.100 N Mapk1 n/a
16 TRCN0000054732 CAAGGGTTATACCAAGTCCAT pLKO.1 848 CDS 100% 2.640 1.848 N Mapk1 n/a
17 TRCN0000195120 CCATTGATATTTGGTCTGTAG pLKO.1 865 CDS 100% 4.050 2.835 N MAPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522147.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488442 ATTCGCCAACATTATGCCGAGTGA pLX_317 28.7% 92.5% 98.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14799 pDONR223 100% 92.3% 62.3% None (many diffs) n/a
3 ccsbBroad304_14799 pLX_304 49% 92.3% 98.3% V5 (many diffs) n/a
4 TRCN0000472350 GGCGCAGTTACTATTGACTTTCTC pLX_317 37.4% 92.3% 98.3% V5 (many diffs) n/a
Download CSV