Transcript: Mouse XM_006522315.3

PREDICTED: Mus musculus trans-golgi network vesicle protein 23A (Tvp23a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tvp23a (383103)
Length:
4207
CDS:
159..854

Additional Resources:

NCBI RefSeq record:
XM_006522315.3
NBCI Gene record:
Tvp23a (383103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268217 TACGGCTACATCCTCTGTAAG pLKO_005 708 CDS 100% 10.800 15.120 N Tvp23a n/a
2 TRCN0000283642 CAACCCTATCATGTCCATTAT pLKO_005 1327 3UTR 100% 13.200 9.240 N Tvp23a n/a
3 TRCN0000283640 GTGTCCCTGGACTTCGGTAAT pLKO_005 192 CDS 100% 10.800 7.560 N Tvp23a n/a
4 TRCN0000268218 TGGATATTTGAAGCCAGAAAG pLKO_005 516 CDS 100% 10.800 7.560 N Tvp23a n/a
5 TRCN0000268245 TTCGATGGTGGAACCAGATAG pLKO_005 475 CDS 100% 10.800 7.560 N Tvp23a n/a
6 TRCN0000269932 TTCGATGGTGGAACCAGATAG pLKO_005 475 CDS 100% 10.800 7.560 N TVP23A n/a
7 TRCN0000047584 CGATGGTGGAACCAGATAGAT pLKO.1 477 CDS 100% 5.625 3.938 N LOC283816 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05741 pDONR223 100% 79% 82.2% None (many diffs) n/a
2 ccsbBroad304_05741 pLX_304 0% 79% 82.2% V5 (many diffs) n/a
3 TRCN0000480830 TATACTAGCCTCATTATCCTGTAT pLX_317 58.6% 79% 82.2% V5 (many diffs) n/a
Download CSV