Transcript: Mouse XM_006522427.1

PREDICTED: Mus musculus LPS-induced TN factor (Litaf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Litaf (56722)
Length:
2122
CDS:
185..670

Additional Resources:

NCBI RefSeq record:
XM_006522427.1
NBCI Gene record:
Litaf (56722)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054931 ATTGCCGTGCAGACCGTTTAT pLKO.1 404 CDS 100% 13.200 18.480 N Litaf n/a
2 TRCN0000309681 ATTGCCGTGCAGACCGTTTAT pLKO_005 404 CDS 100% 13.200 18.480 N Litaf n/a
3 TRCN0000234440 TTGCCGTGCAGACCGTTTATG pLKO_005 405 CDS 100% 13.200 18.480 N Litaf n/a
4 TRCN0000234441 AGCAGCCTGTCTCCTTCTATG pLKO_005 429 CDS 100% 10.800 7.560 N Litaf n/a
5 TRCN0000234439 CAGATGGGAAGGGAATGAATC pLKO_005 336 CDS 100% 10.800 7.560 N Litaf n/a
6 TRCN0000234442 TGACCCAGCTGTCCTACAATG pLKO_005 495 CDS 100% 10.800 7.560 N Litaf n/a
7 TRCN0000054928 GTGTCAACAGTTACTACCCAA pLKO.1 267 CDS 100% 2.640 1.848 N Litaf n/a
8 TRCN0000054932 CTATGAAGAAACAGTGGGTGT pLKO.1 250 CDS 100% 2.160 1.512 N Litaf n/a
9 TRCN0000054930 CCCTACAGGATGTGGACCACT pLKO.1 603 CDS 100% 0.880 0.616 N Litaf n/a
10 TRCN0000234443 CACTGTTTGGCTTGATCTATT pLKO_005 1015 3UTR 100% 13.200 7.920 N Litaf n/a
11 TRCN0000054929 GCAGTCTGTGTCTGCTGGGAT pLKO.1 543 CDS 100% 0.880 0.528 N Litaf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02181 pDONR223 100% 80.6% 85.7% None (many diffs) n/a
2 ccsbBroad304_02181 pLX_304 0% 80.6% 85.7% V5 (many diffs) n/a
3 TRCN0000473183 GCGCATACCTTTCGCATTTTCCAG pLX_317 50.7% 80.6% 85.7% V5 (many diffs) n/a
Download CSV